Description :
From Genome Similarity Track
Location :
Scaffold_41:10636- 12947
Sequence
2311 bases(100 bases per row)
CGAACGGAATAATCTGTCCTGCCCGCACGACGTGTAGTCTAAAGCAGAGGGAATAGCCACTACCATTCCTATGCCACATGATTATCAGGTATTTGTAAGC
TACATCGATCTATTTATCAGGTTCAGTGCTAGTATAATTAAAGTGTCATTCTCGGATAAGATCTGCGCAAACACGCAGGCAGAGAGACGCATCACAAAAA
CAGCGAGACCGGATGGTGGCAAAACGGTGAAGCGGTATGGAATTAAAAGGGACATTACCGATGACGAGAATTCCCGCGGGAATTACAGTTTTGATGCATC
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGTAGCTCATGTACATTAAATGAAGTACTTTCGCTGCCTACTTATCAACTCGGCGTGCTTTTTATGTGTCCGGTCCTTATCCCGCAAGGTGTATATACCA
CGTGCTCGTGATAGCCAGAACATATGCATAGGGCCACTGTCGCTTTCTCGGTGCATTTGCGTCGTCGTGCTGGCTTACGGTGCTTACGCTTCTGATGTGT
CAGTCTATATGACCAAGCAGGTCACTAACTGGACACAGGCCATACTGCAGCGATACAGGTATGCTGAACGCGCGTCTGCTAGCAGTAGCCAACGCGATAA
AAAAGCGAAAGAAGGCCAAAATTTTTTCCCCGAGGGGGGGCACAACCTCCAAAAATTCCCCCTCGCATTTCCAACGCAATCTCTATTTCGGTCATTATGG
GCAGGGCACACAAGTACATTATTGCTTACAGCCACACCGACTTGCCACGTCCATCTGTACGGTCTGCACTGTCACGCAGTGGTAGTATCTATGTAAACAG
CAGCTCATTCGTCGCACGTAGTTCCCACTCAATACTGTGGTTTAAATTGTGAGCGCTATAAGAGCTGATGGTACAGATAACATGGTTTTGCGTGTGCCCA
CGTGAGCGAGGGTACGTGCCATCTACGGTGACGCGTATACAGATAGGGACGGCCAGCTTGCCGAGGTACACAGTACATACCTCGTGCTAGTTATTATATG
AAACGCGCTACGCTCTATAGGTGCGTCAACACGTTTGGTAGCGCCACAGTCAGCTTACAGTATGTGCGACCCCAAGCCTTGCACCGTCAGCCAGTATACA
AAACTATGCGGGGTAAGGGGATATAAGGATGTATATCTAAATCACCTGCTCTTCTGCTTCTTCTTTTGCTCAATGTACCTGACGTTTCGGGCGGTCAGCT
TGCGAGGGCGGCTGTGTCTATTTTGCTTCTTGAGGGCCCATCACCTTCTCGACGTTTGGCAGGCTTTCCTGGCGGCGCACTTCGGTCGAATCAGGTGGTG
GAAGCTTTTCCTCCTAGGACTTAACCGGTTTTGGGCCGTTCTTGCAGGCAATACAGTGTCGCACGCTGCCCCATCCGCTGAATGTACGGAACGCGTAGCC
GTACTGCAGCTTCCCGCAGCAGACGCAGCGCGCCCGGGCATTCGTCGTAGACCGCTGCGGGTTCAGCAGAAGCGGGTCAATCTTCGCCTTGCATTGCTTG
CACGTAGGGCCCACCATTTTGCAAACTGTGAGTATGTTAGCAAATTATATTGTTTTAACCAATTACTTGCGTCCAAATATTAGCCAATAGCACGGTACTG
TAAGGCTGGTATTTATTATTAGACAAAATATTAAAATGTTTTTAAATATTACAATTTGGCTTTGCTATAATATATTATCAGATTTTTAAGCATATACATA
CTTTATATGCAATATAAATTGACTAAATTCACTATGTACCGTGCGCGCATGCATCTGTCGGGTGTGGTGCACGGGAGCAGATAGCGAAATGCCCGTGCAG
CTGCGCGCCTTCATTGCACGGTGGCAGTGGTGAGTTCCAGGTAAAGTACAAAATATATATATTCGCAAAGTCGCTACAAAAAGCGCTGGTCGTGAAGTCT
ACTTTAATATTAAAAATACTATCGTCTCTACTTAAGAAAATGTGTGGAAAATAGCATCGCCGAGATCTTACAAATGCGTCTGTGAAGCTTCCGTTAATTA
AATTAATACTATTAATATCGTCTTTACTTTGAAAAGTGTGTGGAAAATAACATCCCAGAGCTCTTACAGAATACCGGTCTGTGAAGTCTACATTAATAAT
GATAAATATCTCTATTTGAGAAGTGTGCAGAGCTCTTAGAAAATAAAGTGGTTAGTGTGCCCGATTTGCAGTATCTGCGCAGCTAGCCTGGCCGTTTGCA
TCTAATCGATG