Description :
From Genome Similarity Track
Location :
contig_46:106336- 108360
Transcript NameFunction/comments
g9583.t1hypothetical protein

Sequence
2024 bases(100 bases per row)
CGGAGCCTGCTGCTGATCTGCTACTGTTGCTGAGTCCCAGCGAAGTTTGAGGTCGGACTCGCTCTTTCTCGGCTGCTTTGGCTTGCTGGAAGTGCTCCTC
CCACTCCTTTTTCGTGTTCTTGATGTCCTGCGTGGAATTTGGACGCCAATTTGTTAGTGGATGGTCAAGTCTCTCCCGCGTACTGTAGACCACGACACAG
AAGCGTACATTTCGAATGAGCTCGAGTGAGACCTCATTCTGCAGAATAAGCTCTGTCAGCTCCACATCAATCAGCGCGGATTCATCGAGTAGCTATGGCA
CATGTTCGTGAGGATCGTTCGCAAGATATCAGTGGAGGCTGCAAATCACCAGTATGACACTTACCTCTGAATGAGCTAACCGCTGGGGGGCTGTCATGAC
GTCGTTTTGGTTTTTCGTCACAGTTGCTTCCTCCCCGCCTGGCGGTATTCGAGGAGATTCATGCATTAAGCGATTCTTCGGTCTCCTGAGTTTGACGAAG
CAGCATTTCTCTCAGCCGTGTGTTTTCCCTCTGCAGACTTGCATTGTGTTGCTGCAAGTGCACAAGACTCGGTGTTATCGCTCTTCGATGCCAGCTTGCC
TTTTCTGACAGTACGAACCTCTAAAGATTTAACCCGCTTTGTTTCAAGCACACGAGTTGCGCTGGGGTCGCTTTCAAATACGGCCAATCGCTTCTTTAGG
TCCTGAACCTGTTCCTGGAGAATGGGGATGTTGTTGTTCTCCGTCTGAAGGTGCTTGTTTTCCTCCAGCAACGATTGACTAACGGCATCAAGCTGATGTT
CTTACACGTCGCCAGCGTTTCCTATCATTGTGAACGGACCCAACAGAAGGAGCAATAAGCAAACACGCTGGCCGACCGGAAGCACAGACACGTAAGTGCT
TACCATCAATACTTCGATGTGCTTCAGCAGTTTTCGGATCGTTGTGTTGGGGTCTGACGGGTCTACACCAAGATGTGAAGTCGAAACACTGGGAGACAAG
CTCAGTTTCTTTAAATCCCCCAAGATCGTGGATTCTGCGAGGCATCAGCAGCAGCCTCCACCTCTCTCCCTGACAACGGGTTAGCACTGCGCATTTTATC
GACAAAATTGGATGTTGTCGGAGAAGTATCGGTGTCAACGTCCTCGTCACTCGAAAGTTTGGCGTTGGCGTGGTTGGCGGCGGCCTCCACTTCCACTGTC
GACATTTCACCAGCATCTTCGGCCATGTATTCCAACAAAATCGGATGATTGTTGAGAAAGTCATCGCGGAACAGGCGGACATTACCTCGAGGCATGAGAT
TGCTCGCAAAAGGATCGGTTCCATTCGACTTGAAGCTCGCTGCGGTAAGGCTTCCACGAGACCCGGCGCCAGCAGGAGCTGTATATGGCCGAGCTCCGAT
AAACCCGTTGTTTCCCTCTCGTGAGCTCTTGTGCACCGAGGCAAAGAACTCTTCGGTCAAGTCTTTATCAAGTTGCGTGACCTTGTCCCCGTCTAACATC
TTGAGGCGCGAAAGTACTCGCACTACCCGGAATTTGTAGCCTTCAACATCTCTTGAGCAGGGATTGCCACCCAAGTCCAATGCGCGCAGCTACCATACAG
AAACATTTAACACGCAATTTCGTTCAGTCTCGAATAGCACGCAGCAAACAATAAGGGGGTCATATTTGAAGCAAACCTTTGGCAGACCTCGACACGTATG
CAAGGCGAATCAAGGTCAGCTATCTGGTTTCCGTAGACAGACACTGTATTGAGCTCGAGCAGCTTGCGCAGAGGGCTAATGTCCACGATCTGTGAAGCAT
TACCATAGGTTCAGCCGGGCGCCCAAGTAATCTACAAACTACCACCTCAGCGCACAATCAACCTGGTTGTTGGCAAGGAATAATTTTTCAAGCCCCGCAC
ACTGGAGGTTATCGAGCGTCTCGATCTGATTGAAGTTCACATTGAGCTGCTCAAAACAAAAAAGCACCGCGTCAATTGCAACACCAATCTTGATCCCCTG
ACACTGGACTAGACCTCAATCAAG