Description :
From Genome Similarity Track
Location :
Scaffold_87:106332- 107622
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_12075laminin gamma-1 precursor

Sequence
1290 bases(100 bases per row)
CGTAGCCGACGACTTCCGACCATAACATGATCTTGTCTGAAAGTAATTCCATCTTCTCGACCACGCACGAAGCAGAGTACGCCCTGGACAAGTATCCGAC
GCGAGTCTGCGTCTGGCAACACGCCTGGTCACCCTTTTTACGTGGCGAGCCAGCCGGATGCACGAGCGGGCCTTTACCCGAGATGAATGGAAATCACATT
ATTAGTACCCCTTGAACCAACAAATGCCATCAAGGCGCGCGGTGGCTCGCCTCCTTGACGTACTCTTCGGCGTTGGGTGCACTAATCGCGCCTCGAACGT
TGCCAATGTAATTGGCATCGAGGGACTTGATGGCAGCGTCGCAGCGCTGGACCAGCGACTCGCGCTTCGTGCGCTGGGAGTCGTGAACGATTCTTGCCTC
CTTGGACGCGAGCTCGCCTTGCGCCGCGTGTTGCTGCTGGTGTTTATGCCCCAAGGCCTCGCGCGCAGCGTCGTCCCGTCTGACACCAGCCTTGGACTGG
ACCTTGTGCTGGTCCGTCAAGCGGCCGCGTGCCCGCGCAAACGTGGCGCCAGAGGATCCCGTCTCGTCGCGCTCTTGGCGCAGGACGCGCCAGTCTTCGC
CTTCGGCCACGTGCTCGAGGGAAACGCGGTCCGTCTGCTTACGGTCAAGCGCCTTCGCCTCGCGCGTCTGGGCTTCGTCGAGCAACGTTTGATGCAAGCG
GCTGTACGTCGCGAGCCCTTCGTTGGAAATGCTTTGCTGCGCCTTCTGGGCGCTTTGCTTGGCGTCATGGGCCTGGCGCAGGTCTGCCTTCTCGGCCGCG
TGGTTGGTCTCGAGCTCTTCGAGCGCACACTCGAGGAGCATCTTCTTCCACGCGTCGGTCATTTTGGCAAGTGCGCCACGTCCCGTCCCTGCAACGACGC
GAATCCGAAACCAGCTCGACGACCATTAGATGAGCCCATCGCCGCCTCCCACGTCATCTTGGTCAAGGGCCCTTGCCTTGCGTGGTCGACTGCTTCGTGC
AGGCCCTTGCAGCGAGCCTTTGGCGGCACCCGCTGCTGCACAAACCGTTTCACATTGCACTCGACGCCACGGACGACCCATCATCATGACCGTCTCGATG
CTCATGGCCGTCGTCGCCTACGACGACGCCATCGCGCCGCCCGCGGTCGAGTGGTCGTACCCGCCGTACGTGCCGACCGAGGTCATCGACGCGTCGTCGT
CGACGCTCTGGACCGACGAGCTGCGCGCGCTGGTCCCCAGCCTCGTGCGCCCGCCGCGTGACGCCGCAACGTCACCGTACTTTTTCCACG