Description :
From Genome Similarity Track
Location :
contig_46:106330- 108355
Transcript NameFunction/comments
g10047.t1hypothetical protein

Sequence
2025 bases(100 bases per row)
GAGTCGGAGCCTGCTGCTGATCTGCTACTGTTGCTGAGTCCCAGCGAAGTTTGAGGTCGGACTCGCTCTTTCTCGGCTGCTTTGGCTTGCTGGAAGTGCT
CCTCCCACTCCTTTTTCGTGTTCTTGATGTCCTGCGTGGAATTTGGACGCCAATTTGTTAGTGGATGGTCAAGTCTCTCCCGCGTACTGTAGACCACGAC
ACAGAAGCGTACATTTCGAATAAGCTCGAGTGAGACCTCATTCTGCAGAATAAGCTCTGTCAGCTCCACATCAATCAGCGCGGATTCATCGAGTAGCTAT
GGCACACGTTCGTGAGGATCGTTCGCAACATATCAGTGGAGGCTGCAAATCACCAGTATGACACTTACCTCTGAATGAGCTAACCGCTGGGGGGCTGTCA
TGACGTCGTTTTGGTTTTTCGTCACAGTTGCTTCCTCCCCGCCTGGCGGTATTCGAGGAGATTCATGCATTAAGCGATTCTTCGGTCTCCTGAGTTTGAC
GAAGCAGCATTTCTCTCAGCCGTGTGTTTTCCCTCTGCAGACTTGCATTGTGTTGCTGCAAGTGCACAAGACTCGGTGTTATCGCTCTTCGATGCCAGCT
TGCCTTTTCTGACAGTACGAACCTCTAAAGATTTAACCCGCTTTGTTTCAAGCACACGAGTTGCGCTGGGGTCGCTTTCAAATACGGCCAATCGCTTCTT
TAGGTCCTGAACCTGTTCCTGGAGAATGGGGATGTTGTTGTTCTCCGTCTGAAGGTGCTTGTTTTCCTCCAGCAACGATTGACTAACGGCATCAAGCTGA
TGTTCTTACTCGTCGCTAGCGTTTCCTATCATTGTGAACGGACCCAACAGAAGGAGCAATAAGCAAACACGCTGGCCGACCGGAAGCACAGACACGTAAG
TGCTTACCATCAATACTTCGATGTGCTTCAGCAGTTTTCGGATCGTTGTGTTGGGGTCTGACGGGTCTACACCAAGATGTGAAGTCGAAACACTGGGAGA
CAAGCTCAGTTTCTTTAAATCCCCCAAGATCGTGGATTCTGCGAGGCATCAGCAGCAGCCTCCACCTCTCTCCCTGACAACGGGTTAGCACTGCGCATTT
TATCGACAAAATTGGATGCTGTCGGAGAAGTATCGGTGTCAACGTCCTCGTCACTCGAAAGTTTGGCGTTAGCGTGGTTGGCGGCGGCCTCCACTTCCAC
TGTCGACATTTCACCAGCATCGTCGGCCATGTATTCCAACAAAATCGGATGATTGTTGAGAAAGTCATCGCGGAACAGGCGGACATTACCTCGAGGCATG
AGATTGCTCGCAAAAGGATCGGTTCCATTCGACTTGAAGCTCGCTGCGGTAAGGCTTCCACGAGACCCGGCGCCAGCAGGAGCTGTATATGGCCGAGCTC
CGATAAACCCGTTGTTTCCCTCTCGTGAGCTCTTGTGCACCGAGGCAAAGAACTCTTCGGTCAAGTCTTTATCAAGTTGCGTGACCTTGTCCCCGTCTAA
CATCTTGAGGCGCGAAAGTACTCGCACTACCCGGAATTTGTAGCCTTCAACATCTCTTGAGCAGGGATTGCCACCCAAGTCCAATGCGCGCAGCTACCAT
ACAGAAACATTTAACACGCAATTTCGTTCAGTCTCGAATAGCACGCAGCAAACAATAAGGGGGTCATATTTGAAGCAAACCTTTGGCAGACCTCGACACG
TATGCAAGGCGAATCAAGGTCAGCTATCTGGTTTCCGTAGACAGACACTGTATTGAGCTCGAGCAGCTTGCGCAGAGGGCTAATGTCCACGATCTGTGAA
GCATTACCATAGGTTCAGCCGGGCGCCCAAGTAATCTACAAACTACCACCTCAGCGCACAAGCAACCTGGTTGTTGGCAAGGAATAATTTTTCAAGCCCC
GCACACTGGAGGTTATCGAGCGTCTCGATCTGATTGAAGTTTACATTGAGCTGCTCAAAACAAAAAAGCACCGCGTCAATTGCAACACCAATCTTGATCC
CCTGACACTGGACTAGACCTCAATC