Description :
From Genome Similarity Track
Location :
Scaffold_264:10633- 12725
Sequence
2092 bases(100 bases per row)
CGGAACGCGGGGGTGCTTGAGGCTATTCACATAGAAGGGAGTAAAGCCGGTCGAGGCATGAACAGCGTTGTTCAACGCAAGCTCAATGACAGGGAGCATC
GAGCTCCAAGTCTTAGTCGACTCAGCACAAACACTGCGAAGAACATCGCCAATGACGCGATTAACTCGCTCAGTCTGAACATCGGTCTGCCGATGATCCG
CTGTGGGACATGTCCAATCGCGTGCCAAATACCTTGAAGATGGAAGTCCAAACTTGCCTGTGAAGCGAGGGTCTCGATCAAAGATGATTGCTAGCGGCAA
CCCGTGTTGACGAACACACGATCGATAAACAGGATAGCTGTACCTTTGCCATCGATGGAATCCGGTACCGGCGCCAAGTGAGCCATCTTGCTTAAACGGT
CAGCAAAGACCACATTTCCCATATTGCCGTCATAGTCTTCAGGTATACCAAACACAAAATCCATATTGATGGACTCCCAACATCCCGTGGCCACAGGTAA
ACTGGCGAGTGACGCAGTCGAATGTGCTGAGGGTTTGACACGCTGGCACGTTTCGCATGTAAGCACGTATGTGCTCACCCATTTGTAGAGTTTTGGCCAC
CAGTAGTGTTGAATCACAAAGCCATAAGTCTTTTCCCGGCCCAAATGCCCACTGAGGGCAGTATCGTTGTTCTCAAAGAGGATTCAATACTTTAAATCCT
CATTATGAGGCACAACAATGGGAGCGGTATCCGCTACATCTTTGTGATAACACAAGATACCATTATCGATGGAAAATCGATGTAGGCTGAGACGCAGCCG
TGGCGATAACTGACTGTCCAAGGCTTTGTATTCCTCACTTCCAAGGGCATGGAGCAATGCCACACACTGAGAATCCCGTGGATATGCTATACGAATTAAC
TCCTTAATAGGAGACGATAAAGTCGTGACATGAGCAAGCTCATAATCAGGTCGAGAGAGGGCATCTGCCAACACATTTTGGTTGCCTGGCTTATACTTCA
CCTCGAAGTTATATTACGCAAAGAAGGAAATTCACCGAGCCATTCTCTGAGAGAGGTGAGGCGACTGTGTCGCCGTGCGTAATGACGCATGATCCGTATA
GACGACGAATGGCTTGTAGCCAAGCAGATGGACTCTACATTTGACGAGCGCATACTTCATAGCAATTAGCTCTTTGTCATGAACTGGATAGTTATTTTCA
GCAGCTTTCAGCTGACGAGATTCAAATGCGATAACTCGCTCGCGGCCTGTAGCATCTGTTTGTAACAGGGCGCTGCCTATAGCAAAATCTGATGCATCGC
AGGCAACACTAAAAGGGTACTCAGGATTTGGCAACGACAAAATGGGAGCATGGAGGAGACTCTCCTTTAATACCCGAAATGCGTCAGCATGGGTGTTGTC
CCAACGCCAATCTGTATCTTCTTAGGGAGATCAGTTAATGGCCGAGCCATATCAGCGTAATTTTCACTGTATTTGTGTAAGTAATTGGCAAGGCCAATCC
CACTTACGCAAGTCTTTTGGATTCTTAGGAATCGACCAGTCTACTATAGCCTTGACCTTAGCGGGATCCGCTCGAAGGCCGCTCTTACCAATGAAACATC
CTAGAAAAGGAATCTCCTCTGCACCAAAACTGCATTTAGACGCGTTGGCGTACAATTTATTAGCGCGCATGCACTCAAGCACGGATCGCAAATGATCGAT
GTGGTTGTCAACATCTAACCGACCTTGTTCGGCAGGACTATGGACAAAAATGTCATCAAAGTATGTCTGAGTATAATACTGATGAGGCGGAAAAGTTGCG
TCACCATATGATTAAATGTTGCCGGAGCATGAGACAGCCCCTGGGGCATCACCATCCATTCCCATAGCATGCGACTCGGAGTGCTCACTGCTGTAAGCAG
AATATCACTCGCTCACATGAGCAATTGATAATATCCATCGACCAAGTCGAGTGCGCTATACATAGTACAACCAACCATGTTATTTTGAAGAACATCCTTT
CGAGGAATGGGTGTCTGTGCATGAATCGTAGCCGCACTAAGCTTGTTATAAGCATGCACAATACACCACTTGCTGTTCGGCTTTTTGACACA