Description :
From Genome Similarity Track
Location :
contig_2:1063145- 1065762
Transcript NameFunction/comments
g675.t1hypothetical protein

Sequence
2617 bases(100 bases per row)
TCGTCAAAGCTGTGACGCACGTTCATTTCAGGAGACTGTGAGGTCTAGCATCCAGTCCAGTGCGCAGTGGCACCCAGCATGTGCAGGGTTCGCCATGCAG
CGCGAGATCAGGCCAAGTTTCAACTTGAAGAATACAACAAGGCGATATTTTGCTGCCCCCTCCAGCAAAACATGACATAGAGGGTCATACGGATGATAGT
GCGAGCAGCTCTGCGGCCAGTGGAGATGATAGTGAGGCAGGAGATGACGAAGAAGAAGAAGAAGAGGAACGTGACAAAGGTCAACCAGAAGACAAAAAGG
AAGAACTCCCTACAGCCACGGATAATGACGGTGTGGATGGAGACGTAAGTGAAGAGGACGAAGAGAGTAGCAGTGAAGACGAGGAACCTGTTCATCCGGT
AGCGTCAACCCCTGTGAATGAGGAAGACGATGGCAAGCGCTCATTAAACGAAGATACTTTAGCCGAACACACGAACGAAGACTCTAACCAGATGCCACCA
AATGGACGAGCCAAGGTCGAAGCGCTGCTGAAGAAGCCCCGAATTATCAAGCGATCAATTCCTGCCCTTTTCGATGCAACCACAAGAAGTCCAATCTTTT
TCGGATATTCTTTCGAGAAACAGAAAAATCCCGTTGATGAAGCTCTGGAGAGTGAAAGTGCGCTAAGAACGAAAGAAGATGCCATCTTTGACATGAAGAT
CAAGTACCAAAACGATAAGCTGCAGTCGACTAGAGCTTCGGAAAGAGGGAAGCTTCAAGCGCTGACTCAAAAAGAGAGCGGCCTTCAGTTGAAGCGTGAG
AAGCAGTGGGCGAAGAGACAAGCGGACCTCGAGCGCGCGAAAAAAGAATTAGATCCGAGCGATGTCTTCTTCAAAACCAACGAGTCTCAAGACATAAAGA
CAAGGGACCAGGAAGCGTTCGAAGACGCCGAACTTCGACGTCAACAGCAGAATATTGACGCAAGAATGCTAGCAGCAGAGCAGGAGTGTGCACAGTTTCT
GGAACAAGTTGCTGCCTTGCGCTGCCTTGATAAACCGCTGGGGGATCTGCGCTTGACGTTCCACGTAGAAGAGCTGGAGAGGTACGAGCACGAGATCAAT
GCGGCCAAAAATGCTCTTGCCACAGCACAGGAAGAGTATGCGGCACTCACAACGTCCAAGCTTCGGGCACCTGGGCAGGAAGCGAAGCTCCGATCTCAGG
TATTATTCGCTGAAGACCAAATCAAGGCACGGGAAAACGAACTGGAACGCATTTGTCGCCTCCACGAGAACGAACAGTTCCTTCTCGAGCGCGCGCAGGA
AGTTTTTGATAAGGAACAACTCTTCGTGGCTTTGTTCACCTGCCTCAACACCGGGAACGCTTCAATTACTACCAGCATCGACGCCAATTTCGCTTTCCCA
TTGATTGATGTCGCGGTTGCCATGCTTCTAGGGGCTGGGAGATGCTCGATATCGGACAAGATTAAGTTCCTCTTTGAGATGTTTGCTCGGAGAAGCGAAC
GACCACGTGCTATCTCTTCTATCAGCGTTCTGACCTCGGCCTCTCTTGCAGAAGTGCTTCGCGTGGTCTTAAGTGTGCTTTCAAGAATCGGAGATATTCA
TCTTCCGCGTGTTTTAACACGAGAGTTTCTTCAGGAATTTGTGGAGCGCGAATTCTTAAAGCTGAACAGTATATCGTCTAGCGATGATACGGATAACCCC
CCTGAGAGGCAGGGAATGACGCTGCATGAGTTCACCAAATACTGCTTCGAGACGATTGAGGGCTCGAAATATCTGTGTGAACTGTTGGAACATCCTTGGA
AGTACCAACGATTATCCCGTTTTGTGGTGCAACACATGAGTTCCATCCACCAGTACAGACTCGGCTTGATTAACGTCAACGACTTGAAATACGCCCTGGC
TCGACAACTGAATCAACCACGGGAAGAATTATCCCAATGGAAGAAAAGTATCATTCATGATCGTGCACTCGCCATGGGAGAAAATGATCCACTCAAAACG
GATTATTCGAAGTACCTTCCGAAGCGTAGAGCGAAGCTTCTCTCTAACGTCGTGCCCTTGGACCATGGAGGGTATCGAAACTTACTGCACTATCGCATGG
AAGTGATTTTACGCTCTGCGGTAAAACTACAGACAGCTTGGCGCGCCAAAAAGGGCAGACAAGTGGCTCGACTCGCAGCCGAAAAGCAAGCTTTCTATCA
CGCCCGCGGAGTCGCTCTGGAAGAAGCGCGACAGCGAATAGAGAAAGAATGGAGCGATCGAGACGCCAAACCTGCTCATAGCGTGGACAAAATGAAGTTT
GAGGCCAAAATCCGCATGAAGCAGGTCAAACTACGCACAAAGGGGAATACTTTCAGTCGTGAACAAGTGCTTGCGCTCCTGACGGAGGAAGCTGTTCAAG
GCGCTCAAAAGGAAGTCGAGAATCGGTTCCGCGAAATGGAAGAAGAGTTCGGTATCTGAAGCATGCAGAGGCTTTGAAGCTCCACACACAGAAGTGAAGT
ACTTCAGGAGGAATTGCCAAGGGCCTCGTGAATCAACTTGTGCATGCTAAGCAAGAATCAGCTTCCGTTGGGTCTCTGCTGGAAACCATTGCTGTGAACG
AAGAGAAAGCGCGCCAG