Description :
From Genome Similarity Track
Location :
contig_5:106311- 108924
Transcript NameFunction/comments
g1511.t1XP_008897190.1 hypothetical protein PPTG_05399 [Phytophthora parasitica INRA-310

Sequence
2613 bases(100 bases per row)
TCAACATCGATGAGGGTCATATTCCAAGCAAAAACAGCACATGCGCTGCCACAAGTGCCGACTTTGTCGAAGCGACCGCCATCTCGCTGAGTTTGGTATG
AAGTCCTTGGGCAACGCGTGGATCGAGCTGCTCAAACTGTCGTCGATCACGTCTGATGTCTACGGCCCATTGCTGCAGCCACTGCAGCACCATCCACCCA
TCAGACGATTCGTCTTCTTCGTCTCCTTCTAAAAGCAGCAAGAACGCAGTGCATAATGCGTTGCGCACTGCACCTGACAACGTCGCTATGCAAGGAGTTT
TGATGATCGTCGTCGCACGCCGTAGCAACTCCAGATCGTCTTCGACAATGCACAGACGAAACGCTAATTCGTACTCACCGCACTGTGCCGCTTCCAAGGC
AGCCTCGGCACGAGTGAATTCGATCTCGCCAGAGTCATCGTCCTTCTCGTAATTTCTAGCTTCTGCCTCATTGATATGCTGGCGACCCTGCGGGTCATTG
TCTGCTTCGAGTAAGTTCATCGCTTGGGATGATCTCCGCTTGGGGAGGGAAATCTGAGGGATGCCTTGTTGCTGAGAACGCCGTGAATGTGTCTGGGCTC
TTTGCTTCGCTGCAAACTGCTTCAAACTTGTAACAGCTTGTACTGTTGTTGCAGTCAATGGGCGTGACTTTGTTTGAGAGACAACTGCTGTGGATCTAAG
CGGAGCGTTGTGAGCTGTGAATTCTTTGCGTCGCTCTTTGCGGAGAACTTCACTGCTCTGTTCGTCTTCTGATCGCGGGTGATCCGCTTGGTCGCCATTT
GCTGGTGCTGCAGCCTGGTCCATGAGCAGATCCATGAACCTCTCGTCATCTTGGTTAAGCTCAGCAGGTAGCAGGATACTTGTAGGTCTTGCTTCCGTCG
CTATCGTTGTATTCCCCCGCCGATTTGGTCGAGACCGGACGACTTTTTCTTGGCTGGTGGCACTGAAAATTGGCGCTAGATCGTCTCCGTCAGTTGAAAC
ATCATGCGAAGGTAGAGCCTCGTCTCCTGGTGTGGGATCACCGAAGCTTGGTGTGTCTTCCTCCTCTGTCGACTCAGAAGGCAAGGGTGACGAACGTGCC
CTTGCATCACTCACAATCGGGATATGAGTGTCACGATCATTGACCGCTGCAGGTGTTGCCCAACGTTTACCAATGTACGAATAGGCAGGAGGGTTGGGCG
GGACAACGTCGTAGTCTGAACTAGCGTTGGAGCGGGGACCACTGGCTGTTTGCGGGTACAACTTCTCCAAGCGTTCAAATGCCAAGGCTGCAGGAATGGC
AGCTTCGCGAACAAGAGAGACCGAATCGTGTCGGCCAGCCAGCACAAGAGCTCGCACTCGCTCCTAAGTAAGGTCAACAGCGAAACAGATAAGTAAGACT
TGTACTGTACATACAGTTCAAGGTGACTGCACGCACCAACTGAGCTTGAAAGTACCCTCTCGCTGTCCCAACGGAGGTGCACCAAGCAGAGTCCTGCAGC
GCAAATGTGTCAAGTAGCATTGTCAACAGCTCTTGTCCACGCTTCCGAAGTATCCAGTCGTCACGAGGGCCACACTGGAAGGTATCCTCGACTGCTTCGT
AGATTGAAGCGATGTAGGGAGCAAAGTCGTCACCGAGCTGCGTAAAAGAGGCTTGTTCGTTAGCATCTCGCGCTAACTGACACGCCGATTGCAACAGCAG
AAACAAAGGTGAAAAGGTTGCAAACATTGTGCTTCCGTCCATCTTCACAACGGTCTCAGCTAAAAGCGCTTTGAAGAACGGGCGGATGTGTGTGGCATGG
GCGAGCATTGTGGCGGGCCCGGGCACCGACACTCCATCAAAATCGACAGGGTGAAGCAGGCCACAAAGGCACCTGGTGGCTGCCTCCCCTATAGCGTTTG
CCTCCTTGGCAAAAACTGCAGCCACAGCTTCGAATGGCTGCTGAGTGTTACCATTTCCAGGAAGTGATACACTGGGGCATGGCAGAACATACAAGGCAAT
GGCCGACATCAATATCACACATGCATCCGTCGTCTTGGTGTGTCTGTCACGAAGACGAAGGCAAGCATAGGATACAATCCGAGGCAAAAGTTTGGCTGTC
TGCGTTGGATGACATCTGCAGAGAGCTGCGAGTAGAAGAACAAGCATCCGCCGTGTTGACGAGCGAGTGGGTTTCTTCAGAAACAACGCATCGGTACAGC
GTCAGCACCCTCAAAGAGCAGTCAAACATCTATAGCAAGTCGTTCACCTTGTTTTTCTCGATCAGAGAATATACCTCCTTCACCAATGATGAATCCAATC
CTGGTAGAGATTCGCTGCAGCAGGCGAGTGGCAATCGTGATAGTTAGACAAGACTTGGTGTTTGTGCAGGTTTAAATTTCTCACATGAGCATAGCGAAAG
CTTGCTGCTGAGTATCTCGGTCCTCCAAGCGACCGATTTGGACGTTCAGGTTGCAAATTTCTTGTTCTTGTCGTTCCTTGGTCTTGCGGTCCTGCTTTCT
CTTCTTTATGGTGCCTTTGGGACTCAAACTCCCGTTGATGGCCCCAACGACTCCAAATTTCCCATTTTGCCCTGCAGCCCGTCGTTGAAATTGAGTCTCC
ATCATTCTTAGTG