Description :
From Genome Similarity Track
Location :
Scaffold_2:1063069- 1064086
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000799Similar to YHR100C: UPF0660 protein YHR100C%2C mitochondrial (Saccharomyces cerevisiae)

Sequence
1017 bases(100 bases per row)
TGCCATCAACGGGTGCTCAAGTGGCGCCACACCGGAGCGGAGCAGCATGCGGATCATCGCTTTCTCGATGCGCTGCAACTGGCGGTTCACGATGCCCTCG
CCCTTGTGCGTGAACTGATCTGTTCGAATCGTGAGTAGCCCTGTTATATGTAATGGAGAGAACAACCATCAGCCCCCATTTGAATACGCCACATGCTTAT
GGCAAAATGGGGGTAAGCAGAGCGCTGCTCGCGCTCGTACCGTTCATATTGCCGAAGAGCACGTCGGTCGAGTACCGGTCGCCAATCATGATCAGCTTTG
TCGGATCTTCATTCTTAAAGTGCGCCTGCACGTGCGCAATGCCGCCTGGTTTCTATATGCAACACAGAAACGAACCGTAAACAACTCTAGTGTAGCTATG
CGCAATGGATAAACACTCCGTGCATGCCATGCGTTTGTTTGCATTACATACCTTTTCGTTGTGTTGGAGCACGGGAATGTGCAATTTCGCCTCAATCTCG
CGCGCCTTTGCAAAGCCCGGGTCGTCGTTCGAGCCTGCTGAGTTGGAGAAAATCAGCACACGGTCGCCAAACACTTGCCTGCACTCGTCAAACGGTGTCT
ATACGTCCACACAGTACAAACGCATGCAACAAATAGAGTATGCTCGTCAGCAGCTACGTCCGACATGTTGCTTAACATGCATCCATTTGCACGCACCTGC
AAGTGTGCAGCGATTTCATTATGATGAGGGATTGTCAGCGTGTTGTCCTTGTCGAAGATCACGCCTTGAAATCCTCGGTCTTTGAGCGCCTGGAAGGACA
CGTCGTTCAAATCTGCACATGCGCACATGAGCGAAGAGCTCATTTAGTCGTCGACTTTGCGCATGCGATCAACGCAAGCACCCACACGCCAGTAGCTCTG
CGCGTGCGCACGCACCTTTGACGGAGATCTGTGGCAGCAGCAGGTGCGGCTTTTGCACGACGGCACGGCAAAACTCCGTCACGCCGCGCACATTGAGGCC
CTTCATGCTCGCGTCGC