Description :
From Genome Similarity Track
Location :
Scaffold_564:1063- 3121
Transcript NameFunction/comments
Phypl_g9426hypothetical protein

Sequence
2058 bases(100 bases per row)
CCAAGAAGCCGCCGATGCGTCTTCGTTTCCGCCTGTCAAAGACGCGAGAAGAACGTGTCGCTTTGGTGGACACAGGCTGCGGAACGAGCTACATCAATGC
AGATGTGCTAGCAGCTAATCAGAAGCTCGGGTTCGAAATGACCCCTTCGAACTTGACGTACGAGCAGGTCGAGGGCTTCGTTGATGCTGAAGGTTCGATT
CCTGTAAAGTTTCGGTTCATGGATTTGAACTATGGTACCCGTATCACGCACACGTTTTCCGTCATCAAGGACGCGAAGGACGAAATGGTCATCGGTCGCG
ATCTGATGAGCGCACTTGGAATTATCGTCAATTTCTGCGACGGAACGGTTGAGTGGAACGGCAACACAGTTGCTGTCAACACGGGTGCTCTccagaaggc
cgacgagcAGTTGGACGTGAACACCACAGATGAATTGAAAGAAATCAATGACACGGCAGTGAAGCCGGAAGAGATGGTTGGTGCAGCTGATATTGACCAG
TCCACATACGATCGCATCATCGAGCTGCTAACTCACTTCGAGAAACTGTACAACGGGCACCTGGGGCGTATGAAGTTTCCAGATTATGTTCTGCCCATGG
CAAAGGACTTCACACCCGTGCATTCTCGACCATactcgacgccgaggagtgaggaagctgcagcacgtaaGGAGATCCAGCGTCTCATAAAGCTGGACGT
ACTAGAGCAGATCTACGACAGTGACTGGGCATCGCCAGCTTTCTTTTTGAAGAAGCCAGATGGACGACTTCGGTTGCTGACGGACTTCAGGGCGTTGAAC
AAGTTCCTGAAGCGCCACCCGTATTATGTGCCGCTCATTCGTGAAGTGTTGATACGCCTAGGTGGGGCAAAGTTCTTCTCTTCACTCGATGCAAACATGG
GGTATTATGCCAGGCAGTTGGCAGAGAGAAACAGACCACTAACAGCGTTCTGTACGACATTCGGCAAGTTTCAGTACAAAAGACTACCCATGGGAATATC
CACGGCGCCGGATGAGTACCAGGCGTGCATGTCGAAGATTCTAGCGGGTTTGGACTTTGTGATCGTCTATTTAGACGACATTCTCATTTTCTCCAAGACG
GCGGAAGACCATTTGGAGCACCTGCGGGTCGTCTTCAGCCGCCTGCAAGAGTACAATGTGACGCTGAACAGCAAGAAATGCCATATCTTCTGCCCAAGTG
TGGAGTACTTAGGATTCACCATCAATGCTGACGGTATCAAGCcccaggagaagaagatccgAGCCATAATTCAGCTGAAGGAGCCGAAGAACAAGCGGGA
ACTACGCAGATTTCTCGGGATGATCAACTATTACCGGGAGATGGTGTCGGGAAAGTCGGCATTGCTAAAGCCGTTGACGCAGTTGACGTCGCCGAAGGCA
GCGTTCGTATGGACTTCGGTGGAGAGCGAAGCCTTTGAAGGTATCAAGAAGGTGTTGGCGAAGGCAGTTCTGCTGTCCTTCCCGGACTTTACGCAGTCAT
TCGACATTTACGCAGACGCAAGCGGAAAGCAGGTTGGAGGACTGATTCAACAACAGGGAAAGCTGATTGCGTGCTATTCCCGAAGTCTCACGCCAGCACA
ACGAAACTATACTACGATGGAACTGGAGTTGCTGTCTGTCGTGGAGATTCTGAAGGAGTACAGAACGATGCTACTTGGGTTTCCAGTGGTTGTACACACA
GACCACAAGAATCTCATATTTCCCACGGAGAATTCGTTGCGAGTGAAACGGTGGAAATTGTTGTTGTCCGAGTACAAAATCACATGCGAGTACGTCCAAG
GGCGTGCCAatgttgctgcagacgcgtTCTCTCGAATGGAGTATGATGAAAACTCGGAGAGCAAACAATGCAGAGCTTGAGGCGTTACTAATTGAACCAG
TTGACTGTGTTGTGGATGGAGGATACATTAAACAACACCAAAGTGAAGACGAGGCCACGCAAGCAATAATGCAGTCGTGTATGAACAATTCCAATAATCC
CGACTACCAGATCCTGAATATGATGGGTACGAGACTGTTGACTTACCAGAAGCGTGGT