Description :
From Genome Similarity Track
Location :
Scaffold_1163:1063- 2360
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1163-fgenesh-gene-0.0Dicarboxylate/amino acid:cation

Sequence
1297 bases(100 bases per row)
TCGGCATCCCCGGTAACCTCTTCATCCGTGCGATCCAGTGCCTGGTCGCGCCGCTCGTCTTTTGCAGTCTCCTTGTGGGCATGGCGGACATGGTGGCCGT
GGGCAAGGCCGGCGCCATTGGCTGGCGCACGGCCGTGTGCTACCTCTTCACGTCGGCCGTCTCGAGCTGCGAGGGGCTCATCATCGTCATCATCGCGAGG
TCGCACTTTGGCAACAAGGCTAACAAGCAGACCACGAGCGACTCGACCCCGGCGTTCGCGCTCGCCTGCGACCAGCCAGGGTACTTCTTGAGCCACGCCA
ACGACACGGTCGCCTGTGTCTTTGATGCGACCTACAACGCGACCAGCAAGTTCTCCTCGACGTCCGTCTTCAACGTGACCGATGTCCACAAGTCGTTCGG
GTCCGCGTCCACGGGCTTTGTCAAGCGGTCGCTGTCGGACGCGCTCCAGGGCCAATTGCAGACCATGGTGCCGAGCAACCTCACGCAGGCCTTTGCCAAC
GCGACGCTGCTCTCCATCATCATGTTTGCGATCCCGTTCGGCATCGCCATTTCGCTCTTGCCGCGCGACAAGCAGGTCGTGGCCAACTTTTTCCGCGAGA
TCAACTCGGTCTTTATGCACATGATCCAGTGGGTCATCGTGTGCACGCCCGTGGCGATCGTCTCGCTGCTCGCGTCGGCGATCGCCCAGCAGTCCGACCT
CAAGTCGCTCGTGACCGACGTCGGTCTCTACGTGCTGTGCGCCCTGAGTGCGCTCCTCTTCCACACGCTCGTGTTTTACCCGCTCTGGCTGCGCGCGTTT
GTCAAGGGCAACCCGTACAAGTGGATGCGCCAAATGTCGCGCGCACAGATCTTCGCGTTTGGCTCGTCGTCATCCATGGCGACGCTGCCGGTCGTGATGG
ACTGCGTCGAGCAGACGGGCGTCGTCTCACGGACGCTCTCGCGGTTCGTGCTCGCGCTGGGTGCGACCATTGGCATGGACGGCGCTGCGTTGGTGTACCC
CATCAACATTGTCTTCATGGCCGAGACCCAGGGGCTGGGCCATCTCATTGGCGGCGTAGAGTACTTTCTGATCGCGCTGGTCTCGACCATCGGGTCAGTC
GGTGCCGGGCCCGTGCCGTCGGCGGGCAGTGTCATGACTATTACGATCTGGGCGAGCGTCTTCCCGAACCTCGCGCTGCCGGCCACGTTCGCCTACGTGA
TCGCTACCGACTGGTTCATCGATCGTTTCCAGACTGTCGTCAACGTCGTCTGCGACACGGTCGTCACGCGCATCGTCGCTGAGGTCGTGGGCGAGAC