Description :
From Genome Similarity Track
Location :
contig_5:106280- 108893
Transcript NameFunction/comments
g1631.t1XP_009517271.1 hypothetical protein PHYSODRAFT_294930 [Phytophthora sojae

Sequence
2613 bases(100 bases per row)
TCAACATCGATGAGGGTCATATTCCAAGCAAAAACAGCACATGCGCTGCCACAAGTGCCGACTTTGTCGAAGCGACCGCCATCTCGCTGAGTTTGGTATG
AAGTCCTTGGGCAACGCGTGGATCGAGCTGCTCAAACTGTCGTCGATCACGTCTGATGTCTACGGCCCATTGCTGCAGCCACTGCAGCACCATCCACCCA
TCAGACGATTCATCTTCTTCGTCTCCTTCTAAAAGCAGCAAGAACGCAGTGCATAATGCGTTGCGCACTGCACCTGACAACGTCGCTATGCAAGGAGTTT
TGATGATCGTCGTCGCACGCCGTAGCAACTCCAGATCGTCTTCGACAATGCACAGACGAAACGCTAATTCGTACTCACCGCACTGTGCCGCTTCCAAGGC
AGCCTCGGCACGAGTGAATTCGATCTCGCCAGAGTCATCGTCCTTCTCGTAATTTCTAGCTTCTGCCTCATTGATATGCTGGCGACCCTGCGGGTCATTG
TCTGCTTCGAGTAAGTTCATCGCTTGGGATGATCTCCGCTTGGGGAGGGAAATCTGAGGGATGCCTTGTTGCTGAGAACGCCGTGAATGTGTCTGGGCTC
TTTGCTTCGCTGCAAACTGCTTCAAACTTGTAACAGCTTGTACTGTTGTTGCAGTCAATGGGCGTGACTTTGTTTGAGAGACAACTGCTGTGGATCTAAG
CGGAGCGTTGTGAGCTGTGAATTCTTTGCGTCGCTCTTTGCGGAGAACTTCACTGCTCTGTTCGTCTTCTGATCGCGGGTGATCCGCTTGGTCGCCATTT
GCTGGTGCTGCAGCCTGGTCCATGAGCAGATCCATGAACCTCTCGTCATCTTGGTTAAGCTCAGCAGGTAGCAGGATACTTGTAGGTCTTGCTTCCGTCG
CTATCGTTGTATTCCCCCGCCGATTTGGTCGAGACCGGACGACTTTTTCTTGGCTGGTGGCACTGAAAATTGGCGCTAGATCGTCTCCGTCAGTTGAAAC
ATCATGCGAAGGTAGAGCCTCGTCTCCTGGTGTGGGATCACCGAAGCTTGGTGTGTCTTCCTCCTCTGTCGACTCAGAAGGCAAGGGTGACGAACGTGCC
CTTGCATCACTCACAATCGGGATATGAGTGTCACGATCATTGACCGCTGCAGGTGTTGCCCAACGTTTACCAATGTACGAATAGGCAGGAGGGTTGGGCG
GGACAAAGTCGTAGTCTGAACTAGCGTTGGAGCGGGGACCACTGGCTGTTTGCGGGTACAACTTCTCCAAGCGTTCAAATGCCAAGGCTGCAGGAATGGC
AGCTTCGCGAACAAGAGAGACCGAATCGTGTCGGCCAGCCAGCACAAGAGCTCGCACTCGCTCCTAAGTAAGGTCAACAGCGAAACAGATAAGTAAGACT
TGTACTGTACATACAGTTCAAGGTGACTGCACGCACCAACTGAGCTTGAAAGTACCCTCTCGCTGTCCCAACGGAGGTGCACCAAGCAGAGTCCTGCAGC
GCAAATGTGTCAAGTAGCATTGTCAACAGCTCTTGTCCACGCTTCCGAAGTATCCAGTCGTCACGAGGGCCACACTGGAAGGTATCCTCGACTGCTTCGT
AGATTGAAGCGATGTAGGGAGCAAAGTCGTCACCGAGCTGCGTAAAAGAGGCTTGTTCGTTAGCATCTCGCGCTAACTGACACGCCGATTGCAACAGCAG
AAACAAAGGTGAAAAGGTTGCAAACATTGTGCTTCCGTCCATCTTCACAACGGTCTCAGCTAAAAGCGCTTTGAAGAACGGGCGGATGTGTGTGGCATGG
GCGAGCATTGTGGCGGGCCCGGGCACCGACACTCCATCAAAATCGACAGGGTGAAGCAGGCCACAAAGGCACCTGGTGGCTGCCTCCCCTATAGCGTTTG
CCTCCTTGGCAAAAACTGCAGCCACAGCTTCGAATGGCTGCTGAGTGTTACCATTTCCAGGAAGTGATACACTGGGGCATGGCAGAACATACAAGGCAAT
GGCCGACATCAATATCACACATGCATCCGTCGTCTTGGTGTGTCTGTCACGAAGACGAAGGCAAGCATAGGATACAATCCGAGGCAAAAGTTTGGCTGTC
TGCGTTGGATGACATCTGCAGAGAGCTGCGAGTAGAAGAACAAGCATCCGCCGTGTTGACGAGCGAGTGGGTTTCTTCAGAAACAACGCATCGGTACAGT
GTCAGCACCCTCAAAGAGCAGTCAAACATCTATAGCAAGTCGTTCACCTTGTTTTTCTCGATCAGAGAATATACCTCCTTCACCAATGATGAATCCAATC
CTGGTAGAGATTCGCTGCAGCAGGCGAGTGGCAATCGTGATAGTTAGACAAGACTTGGTGTTTGTGCAGGTTTAAATTTCTCACATGAGCATAGCGAAAG
CTTGCTGCTGAGTATCTCGGTCCTCCAAGCGACCGATTTGGACGTTCAGGTTGCAAATTTCTTGTTCTTGTCGTTCCTTGGTCTTGCGGTCCTGCTTTCT
CTTCTTTATGGTGCCTTTGGGACTCAAACTCCCGTTGATGGCCCCAACGACTCCAAATTTCCCATTTTGCCCTGCAGCCCGTCGTTGAAATTGAGTCTCC
ATCATTCTTAGTG