Description :
From Genome Similarity Track
Location :
Scaffold_127:10623- 14974
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_127-snap-gene-0.14Sel-1 suppressor of lin-12

Sequence
4351 bases(100 bases per row)
TCGCTCCAGGACTTTGAGAAGCTCGGGCTGCTCGGCACGGGCGGCGCCGCAGTCGTGTATCTCGTACGCCATCGCGCGAGTCGTGAGCTCTTTGCGCTGA
AAGTGCAGCAGATCTCGCCTTCCGACCTGCAGAATCGCCAGGTGCGTTACATAGTTTTTGGCTCTATCTCGTAAGCTGCATGGCGCTCAGATAGTAACTC
TACTATGTTATGCTGCAGACCCAGCGAGCCTTTAAAGAGCTGCAGATCCTCAAGGCGCTCCAGCACCCGTTCATTGCGCGGCTCCATGATGCCTTCCAGG
TAAGGACCAACCCACTACTGGTTCATCTAATCATCAACCCAAGTCCTCACTCTATAGCTTCTCCTGCAATCCATATCTGTCTATAGGACGGCACAAACCT
CTGCCTTGTGCTCGAGTTCTACCAAGGCGGCAACTTGAACGACGTCCAGTCGTTCTGCGGAGGCACGTTTCAGGAACCACTAGCCAGGTTCTACGCGGCG
GAGCTTGTGCTCGCGCTCGAGTATGTCCACACCATGGGGTTTGTCTACCGGGACCTCAAACCGCAGAACGTGCTGGTGCAGGGCGACGGCCACATCCGGC
TCACGGACTTTGGCGTTGCGCAGCACGGTGACCACATTGGCAGCAGTGATACTGGGTACACGGACGACCGCGTGCGGCTCCGCTCGGGCTCGTTCGTGGG
CACGATGGAGTACATGGCGCCCGAGATGGTCCAGCAGAAGACGCAGGGCTCGGACGTGGACTGGTGGACGCTCGGCTGTCTGCTCTACGAGATCCTCTAT
GGAACTCCACCGTTCAGTTCTTCTCCGATTCGAGGTGAGTGCGACTCGAACCGGGAACAAGACCCAGCGGCGCTTTTCAAGGAGATTCTCAAGTGCCGCG
TGCAGTTCCCCACTGAGAGGCGCGTGAGCGACGACTGTAAGGATCTCCTGACAAGGCTACTGGAGAAAGATCCCACGAAGCGGCTGGGCCATCGATTCGG
CGCCTGTGAAATCAAGCGGCACCGGTTCTTCCAGGGTACTCAGTGGGCTCTGGTGGGGAACCAGCCACCTCCAGTGACTGTGGGTAGCTCGTCATGTACC
CAGCGGTTCCATCCAGCTAGCCTAGGCAACAAGGCTTTGAAGGAGCTCGTCAAGATTGAGCAAGCGCTTCTGGGAAAGTTCGACTTTGACGACTGGATCT
GGGCACTCGACAGTGTTGACCAGCAAGGTTGTGGAGACTCTGAATTAGAATCAGAGGACGATGTCGTGGTGATAATCTCTGCAGCTGAGAAGCAGCTACC
GTCGCTCTCTAGGAGCTCGTCGACGATCTCAAATCCGGAAGACACGTGTGACGAAGAGCTCGACCGAGTGCTCATCCAAGTCCTCGATGGCGGCGATACC
CAGTGTCGAGAGTGTCAGGCGCCTGACCAGCGCTCTTGTTTGCAGACCAAGTACCAGCGCAACGAGCTCTTCTGCCAGCCACCACACCAGTCGTTGCGAC
GTGCGAGCTCGTTCATCGACACTGTGCTGCGAAGAAGCCGTCAACAGGGTTCAGTGGCCTCTCAGTCGGCATCCACCGTGCGAGCTTCGTCATTATTCCG
AGCCCAGACAATGTTGAAATTGGTCGGAGGGCTTGGAACTCCCCAGTCGCAGTCTCAAGCAGCGCTGCTCACGAAGGAGAAGAGCGCGTGGACCATCTTC
ACCGACAAGGCAGCCACCTTCTTGGACTAGCTACTCAATAGCACTCTATTTATTTGTTTCTCTTACGCTCACGTCAGTTCTGAGTTGGTGGGAACTGCAC
GAGCTCTGGCTCAATGCTGGCAGCAGCGTAGATGCGAGCGTTGGACTTCAGCTCTGACGTCGTGCGCGCCAGTGTTGTGACTTTGCTACTCTCGTCTAGG
GCTTGGCGTTGGATCTGAAAATGCAGCTCTACTAGCAGATTCGCGTGATCTAACTCGTGCTGCTGTGTGAGCATCAGTTGACGCATCGACGCTACAGACT
CGACCGATTTCCACACGCGAAAGTGCATGAGGCTGCCCAGAAACTGCGAAGACTCGAACGATGATGGAGAGCGAGTGAGACTACTCCCCACAGAGAGGAT
CTGTGGCTGCCGACTGTCACTGGAAGGCAATTCGTGAACTTGAGACCACCAGCTGGGGAAGAACTCGAGCTGCTGCCGAAGCTCACCATCCACAAGCAGC
GAGATCGTTGGCTCCGAGTCTCTCTGAGCAGATAGGACGATGGCGATGTGGTACCATTGACCAACAGTCAATGGGCCATTCACAAACACAAAGAGTGCCG
ATTCGGTTCGGAATTGGAGCAGCCACTGCTCCTCACTGGTTGTGGACGTCGTGAACTCGAGCGTGTACGTGTCTTGCAGGTCGAGCAACACCATGTGCGT
TCTTTGACTGCTGCTTGCTCGCTGAGTCTTGATCCAGGTTTCCACAGTGACAGACTCTGGAGACTGGGGCACTTCCACCTGCAGCTTCGAGTCTTCAGTG
AACCGCAAGGCTGAGGCAAACGTCACGGCATCTCCTTGAGCTGGCTGCTCGATCTCAGACTTGACCAGTGACTTGGGCAGATCAGGCTGGCGACGTGGCT
CGGGCTCATCCATAGCAGGACCATGGCTCTCATGAGACTGAGGAGTTAGAGGCTCCACTACGCCACAGACACGTTTAACAAGGCTCCTCACTGCTGTGAT
GATCTTCTCGACGTGACTCTGAGCCTTGAGCTTGAGTCGGATGAGCCATATGACCTCTTTCATCGCTGGTTCAGCACTGGCGACCAGTTCGTAGTACAGA
CTCGCTTGCTCGAGAGACCGTGAGACCACTCCCAGCCCTTTCTCATGCATGTACGCCATGCTGAAGAGCGCGCACCCGTGTTTCCCGTGGCTCAAGTAGT
CTGCAAGCTCGTACTGCAGCATGGCGAGTGCAAAGTTCGACTCGGCAAACAGGAGATCGCCATATCGCACGTGGGCATCGGGGCTATCCTGCGCCACGCC
ACGACCAACTAATTTCGCATAGAGTTGCTTATTGGGTGCCTGCTGGCGCTCCAAGAGCCACGCGGCGTTGCTCTCCGCGACCTCGTAGCCCATCTCAGCA
GCCACGAGGTAGAGCTCAAGCGCCCGTGGCCAGTCGTTCGCAAAGAAGAACGCCGCGGCCGCGCTCTCGAGGAGATCCGTCCCAACTTGCACGTTCTCCG
CCACCTGCTTGTACAATCCCACGATCTCTTCACAGGAACCAGCAGTTCTCCGTTGTAAGTGGGTCTTGGAGGCACTGAAGCGCGCCTTCTCCTTTAGCTG
CGCGAGCTTGAACTGGGCCTTGAGGTGGCCCACGTGGGCCGAGGCCTCGAGGTACTCTTGGGCGCGCTGCGGATGGGCCTCGGAGAGCAGCACGCCCGTG
TTGTAGACCCCGTCGGCGTGGCCCTTGCGTGCCGAGACCTTGAAGAGCCGCATGGCCCGCTCGTAATCCACTCGGGTTTCCCCAACGCCGTGAAAGTAGA
TGAGTCCGAGGCCGTTCGCAGCTTCGGCGCTGGTCGCATTCACGACCGCCGACTCGTTCAGCGCTTCCTCGTAGAGCTTGATGGCCTGCGGAACGTCTTG
GCCAAAGCCGCTGAGCCCATAGGCGTACACGTGGGCCAGCAAGGCCTTGGCGGAGAAGCTACCGAGCCCCACAGCTCGGTCCAGAAGCGCCTTGGCCTCG
AGGTTGCGAGCCGAGGTGAGCTGCTCGTGGTCCTGGTCTTCGTTGGTGCTGAGAGTAGCCTGATCCAGGTCGCTGAAGAGCACAACGCTCGCAGCTTTCA
CCAGTAGCGCGGGGTCGCTCGAGCTGTGCGCTCGCTGCCTGAGGTACTCCATGCGGTGCGCGTCCTCACCAGCGTGTGCTGGCGGCCGCTGTCTCTTGCT
GCTGCTGCTGTCGCTGAGCTTGAACGGCGCTGGGCTCGAGAACACCTGCACAGGCTGCGAAGAGCTCTGGCTGTTGATCACGCGGTCGGCGGCAAACTTG
TAGTGCCGCAGCGCGGCTTCGCAGGACTTGGGCACGCCGTAGCCGTGCAGATGGCGGTAGCCGAGCGCCATAGACGCTGCGACCGAGCCGCCGCGCGCTC
CAAAGTTGTGGTAGAGTACGCTCTGCACCTCATGGTCGCCATCCTGCGAGGCCAGGAGCGCGCCGAGAAGGAACTGGGACTCGGGGTTCCCGAATTCATC
GGCGCTGACGTGCAGTAGCTGGCCTGCTATAGAGACGTTGGTTGGCGTTGCGAGGTCGCCTAGGAGATGCAGGCGGCCTGCTTGGAGCAGGAGTTGGCCT
CGCTCTTGGCTCGTGAGCTGCTGGAAGAATGGCGTGGAGGTGATGGTCTCG