Description :
From Genome Similarity Track
Location :
Scaffold_228:10620- 14380
Transcript NameFunction/comments
g8936.t1hypothetical protein

Sequence
3760 bases(100 bases per row)
TGTGCTCGCGATCGACGCTCTTGCTGGTGGTAGAAGTAGTTGTAGTTGAGCTGCATCACAATCTCCGTGACGTGGGGAGACGCGCCGTGCTTCTGCATGG
CCGTAAGCATAACTACCAAGAAATGAGACTGCCGCTTGAATTCTTTTGAGCTTCTCGTCATTTCAGCGTGAAGCACACGAAAGTCAGGACGGTCGAGTAG
ACGGGCGCTCAGCAACTTGTCACCGACTTGATCCATGGCCTGCTTGGACTCTGGGAAATATGTGTGCATATTCCGGTCAACTGTGCTGACGAACTCGTCA
ACTTGGCCAACAAAGCGCAAGATATGGTTGAAGGTCGTCAGGATGTACTGAATCACTGTCGCGTGCTGCATGATCAACACAGATCATGTGAGCACCTCCC
GTATTTTTGAATCCAGCGGTTAAATAAATGCGTTGTACCTTGTCCAGAAGAAAGAAGCGATTTAGCAAGTCATCAAGATACTGCTCGTGAGTAGCATCCA
TCTTCTCACATAAAGTGAACACCAGCACAAATGCATACACCAAGCAACCAAACGCTTAGCGAGAACCATCAAAGGGGCAGATATGTAAGGCTCATACCGC
ACCTCTCCTAAGCTTCGTGAAGATAGCATAACCTGGCGATATTTGGACCACCCTTGGCTTGATACCTGTGGCATCTCAGATATGTGAGCACACCAAAACC
ATGGAATATTCCACGTACAGACTTGTACCTGACTCGTGAGATAGCTCAGCAAGCTTTTTGTGAAATGCAGCATATCTGCCATTTGAACAAGTAGCTGACG
CATGTCTTGCTCAATGCTGAAGCATACAGAAAGAACCACGAAGTCAGCTTCAGCCACCGAAATACCAATTCGAGATACCGTTTACATACAACGAGTAGCA
TCTTCGATGTCGAAGAGTGGATTTGAACTGCAATGAGAAAGAACAGCTCGAGTAAAGTCAGCAACATACGCACATTTAGAGTATGTAACACACACTACCT
TGACAAGGGCCGATTCGACAGCCTTCACTTGAACCAGGAACACCCCAAGTCTAGAGTATTTTTGCATAATTGAAGCACTGAAAAGTACACGCAGCGGCTG
CTGCGCAGCAAACGTGAAGTGCATACACTTCATCGTTGCAATATCGATTCTTGCACTGCTGCTAGCACTATCCAGCAAGCTGAAGTCAACTCGAACACGT
AGCCGACCACCAATTTGCCGCTGCGAGGGTGATAACGAGTTGTTTTCAAACACCCCTTGTACCGCACTCTGATGAAATACGTTGAGTTTCTCACTGTCAG
CCCACGCGACTGGGTTTGATTGCATGTGAGCAACCAACTTTTCGGTGAAAACACTAAATACGTCTTGCTGCGGATAAAACAAATGCAACAACAGCAGAAG
TGTTAGAAGGTGTTACCTTAATCGGTCACACTCAACGAACAGCCTACAAAATTGACTCACCTGCCCCATTAAGACAAGCATGCGAAGAGCATCTACGTGC
TCCATGTAGCACATTTCGTCTCGAAAAATGTCGGTAATTTCGCTGTTAAGGCCCTGACACTGAACCATCCAGAAGGAGAGTGTGTTAGTACGCCACCCCA
ACGCACAGAAAGCAGTCAGTTAACACACCTTGCTTTCGATATGCTGGGTGAGACAACGCTCCAAAATCCTGTTGAAAGGTATGCATTCTAGCATAATTTG
TTGAGAGGAAGGACAAGCTTCTGCGTGGCCTTGAGCCGAAGTTGTAATCACCGACATAATTCTATGGATGCGTCTGCAGCCCATCGCCTCCAGTTCACTT
GCAAGTAAATCACATAGAGAAGGCTGCAGTAGTTCAGGTGTAGCAATAGATTCCACCTCCATGTGTTGCTGCTGCAGAAATCGATTCTTCATTTGTCGGC
TGGCTAGCGCCTCATTCATTAAGTTTGTCATTGACTCGAGAAATACAGGAACGAGCGAGCGATTTATTTCGAAGGGAGCCAAAGTCAGCAACCCGTCGCG
AAAGGTTTGGTTCCTTTCACGCATTGGCGATGCACTAACGCTCAGTGATGCAGGCGTTGCAAAAAACAGCTCTCCATGAAGAGGAATGACATCAAAATGG
CTTATCTCAAAGATCATCCGGTTTATCAGACCCAAGTACGGATTCAAGGCGCCAATAAATAGGTGTAGCAGAACATCGGATCGTGGCAAGTTATCTGCAA
TACTTGAATCGGCTGACAGCCCCTCCACGTACTCTAACTCCATCATGCGGTACAGCGCATCGAGCACACATTTTGCCCGCTCAGCGCGCTTTACTCCATG
CCAATGCCGCTCCGATAAACCCTGGAAGCATTCTATCAGAACTCTCTTCAACCATGAAATCATCAGAAAAATCTCCTTCAGGCCACCATAGATACCCAGC
AATGTAGGCTGTCGCGACGCAATGCCAGACCACGGACTTGGGTCCTCGTCTTCAAGGTTGACTGCAGTGTTGACTTGCAGCTCCACCTTGCGTATCGAGT
CATTTACATTCCCAATGACTTCTGATAATGAATTGGCCAAGCCTTCCAGAGTTACGCATCGATGCTGTTCACTGAAGTCTGGCGCATGACGAATAAATCC
AAGTAAATCTCGAAGCAATTGCAACTCTGACGCTGCTTGTGCGAATTCACTCACAACATGGTGAAAGGCCAAGGGAGATAAATGCCCAACTGCGACACCT
AGCGACTGTCGAGATCGCTCAACCGTCATCGTCTGGAAATCTAAACTAAAGATCAATGGAGTCGGCTTAACTGGGCGAAATTCAAACAGGAGCGAATCGA
TGCCATCAAGTGCTTCGAAAACCATACTCACCACAGTTTGCTCGTGGATAAGTCTACGAGGGATAATACCACTCGTTGTCCACCCGCCCTCTGCACTCTT
GACCACCGCTTCACACAAAAGCCACGGCCGGTCTAACGTAAACGGAACATGCTCACTCTTTTCCATCACACACGTCGGATCTTCAGCATCATCAACCACC
ATATCTTCTTCATTTCGCAGCAAAACTTCTGGGTGATAACGGCACAAAACGTTATCCCGCAGCCTTTCTCCCTCCGAGAACTCTCGTCTCGTTCCACCGT
GCTCTGCACTCTCCCCACTGGCAAGCACACTGCTCACTCGAGAATCCGGCAGTGGCATCACCTCCTGTCCCCCAATCGCATCACCCTCCTCTTCCAATGC
CTCACTCGTCCTCTTCCCATTGCGGTGGCACGAATCGACACTGCGTTCCCTCCCCACGCTGCTCATTTCCCAGTCACTTTCCTCGTCACTTTCCTCCCAG
GCTTGGTACCACTCGTCATTGGTAGAGATCTGGAACAGCTCGTCCACCAGTTGATCCTGCATCTGCCTGTGCTGCTTCTGCTTGAGTTGCTCCTGCTGCA
GCACCGTTTTCCACCTGCTGTCGGCGTCCTCATCCACGTCCACATCTTCGTCTACTGCTGTTGTTGGGGACGTCGCCAGCTCTAGCAGAAGCTTCAGCAC
TTGGCAGTCGCAATGCGGAGACAATTGCAAAAGTTTGTCGGCTCGATCCTCCAGCGAATGGACGCGGAACTTGGTCGCTAGGGCTTCCGTTTGCTGCTGC
ACGTCCTGGGGCAGAGTGTCCACGAACCGGTGCGAGTAGAACTGCCCCACGACGCGGTCAGCGCGCAGTAATAGTGCCTCCTGGGGAAGTGGGCGCTTGG
CTCCTTCATCAGGCGTATGGGTGTCGCTGATGTGGGCGCACAGCTGCTTGGCGAGAGGCC