Description :
From Genome Similarity Track
Location :
Scaffold_291:10620- 11738
Sequence
1118 bases(100 bases per row)
CTTCACTGCGATGTGAAATATCGGAATTTCTCCTGTCCCAATCGTACCATTGGTCAGCTTCATCCTCACGCTCGAGATCCTCATTGCTCCAATCTTGCTC
AATAAGCCAGCGCACGACGTTTAGATGCCCATTCTCAGCTGCCTTTAGCAGCGTCCCAGTATCCATGCAAAACTGATCGTCCAGCCATTGCAAGAGTTGG
AGATGTCCACGAGAAGCAGCGCCCACTGTGCACTGCGGAGGGGGGATGCGTGTTATCCGCTGTACTAACTCCACAAACTGAATGTCTCCACTGGTAACTG
CAGCTTTCATCGTTGCCACGCCATCTCTTTGGTCTTGTTCCTCCGTCGTCTGGAGCCACGCGACCACATCTGCGTGTCCTGCTGCAGCCGCCCTCGCCAT
GTCCCGACTACCCCAACAAATAACGTGATACGGTTCCGACGCATCGTCCGGCACTTCACTGCCAGCCGAATTAATGTCTTTCTCTAAAAAATATCGTAAA
ATCTCCATGTCGCCTGCAGCTGCAGCTTCCTCCACGGCGTCCTCGAGGACCCAAAACTCTGGGAAATGAGCAAAAATCCACCGGACAATGTCCAAGTCTC
GGCGTTTTACGGCCTCCACGAGCGACGCATTGGCCTGGAAGGACTGGTACCAAGGCTCAGAGCGTAAAAGACCGCGAATGGACCAGGACGCGTTTGCTTT
CGCCTCCAAATCCAGTTTGCAGTCCCAGATCCGGTTCAAGAGCGTCAAGGACCCGAATTTGCATGCTTTTGCAAGCGGCAACTGCACCGACGCATCCACA
TACAGCGACACCGCATCAATCACATGAGAGAGCGCGCTAAACTCGGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
CAGTTCGTGACGGCTTGCTATTGGTTCTACAGGTGGTGGATATTATCCAATCACCCACGTTCAACTCGCGGGTTTCGCATTCAAACCCGGGTTTGACATC
CAATCCAGTCACTCATTGGCTAAAAGTCGGCGGGCTCTCCTCCGCCAGTAAACCAGCCGACCCGCAAAAAGTAACTAGCCTTCGCAAAAACTTCATTCCC
CGGAAGACTCCCTCAACC