Description :
From Genome Similarity Track
Location :
Scaffold_1588:1062- 3663
Transcript NameFunction/comments
Physo_126801gag protein
Physo_126802reverse transcriptase

Sequence
2601 bases(100 bases per row)
CCTTGGTGTAGACACACCAAAGGCTACATACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGCAAGCAGCATCTTTT
AGCCAATGAACACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAAATTCCCAGTTTAGAATATTACATTTCGAGGAAGTCAGAAACATAAAAC
AAAAGTAGCAGTTCTCATTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATATATACTCGGAGGTCCGAGTATAATTAACTCTAGTTTAAAC
TAAGCTACGCTTCCTCATACACGTGCGCATACGTGTGAGCCGTAGTAGTGAGCCAAGGTAGGCCCACTACACCTGGTAGCACTTTGTAGTCCGTCCAACG
ACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAACT
CACGTTGCACTCGCTGACTGTCTCCACCTGTCGGATCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGTGAGTCGGCTGTAGCTACGATGC
TGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCGGTGCCGTCCGGGAC
GACACCACGCGCGCAATCGCTAAAGCTCAATGTGAGCAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCATT
GCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGAACGCCGACTCTCGG
ATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGACAAGCGTTTGAGCCACCACAAAGCGAGTTCCGGTCGAGGGCGGAGTTCCTCGA
CCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGACGACCAAGGTC
GTCATGTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAGG
AGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGTCGAGGCCACAGCCACGCCCGGTAGTGAGGACAGGAGGCCCAGAACCCATGGACCTCTC
AAGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCCCC
GTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTCGACTCGAGTAGGCGCGGGGCGCCCTACTGGTAATGC
GGTTCCGCGTGTTGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGGATTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGACATTGTCA
TGTTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGTGTCGAAGAACTTTGTTCCACTGCGAAGTCTATCAAGGCT
TGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGACAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGCTTC
ACGTATGAAGATCAAGAGTTTGTCGAGACGTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATC
CGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCGCCGACAGGTTC
GCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCAAGCACGCGCGCAAGAGCAGCTAGCGTCGGCGTTGCCG
CCGACAGCTAATGAAGGAAATGTGTTGACCTCGGTGGTCGACACCCGCTTTTCAGCGAATCACGAAGCGTCTCCGGCCTCAAGGGGCACGGATGACGCAG
GCGGGTTACACGCCTCAGCCGTGGAGACTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCCAACGTGACGAAACGCCGTCGACTCCGGG
AGTCGATGGCTTGGGTGAATTTGGTTCGTCGGCTCGGGGATCCGACGCACCCTCCGTAATGGAGGGCTCCGCCAATAACAGGCGTCGTGGTAAGGATGGC
GTGTCGACTCCGGGAGTCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACTGGAAAAACTTTCATGCTGTCGTGCACCCGGGCTGCACGACG
AAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATAACCCGCCGGCGGTACTGACGAAGAACACCCGTCCACGGCTGGGCCTGGACGA
G