Description :
From Genome Similarity Track
Location :
Scaffold_2394:1062- 3230
Sequence
2168 bases(100 bases per row)
AACGTAATTAATAATACAGTGCGGCGGCGGTTGGCTGGTTTTCAGCGCGCAGAGCTCCTGGGCGAGCCTTCGCGCGCACGAACTCCTGGGGCTCACGGGG
CAGTGTAAATGTAATCCTGTAGTTTGGATGCCCATGGCTCTTTTGCAGAGAAACACGCCGTTTAGCGTGGTACAGCTATTGATCTAGGTAGTCGAAATGC
TGCCATGTTGCCATGTTGATGAGGCCGATCTTTTGATGTTTGTGCCGCCGCAGCCAGCGAGCGAGTTCCAACacccaacaacaacaacagcacccGTCTC
AAATTGGGGATCGATCTTCGATCCAAAGCTCTTCAACAGGCGCCGAGAAGCACGGATCGAAACCAGGCACCGGCTATCGTGGCCTCGTTCCACATCACTT
GACGCCAATCtccggtgctgcagctccttgtaCTTTCGTCACGAAATTCGTGTCGGGAACATAGAGAGAGACATAGGTACGCTGCCCTCCCCTTTAACGC
TCGCGATGTCACGTAATgctcgctggagctggatgtCCGTGCGGAGCCGCGGCGCGCAACCTCGACGCACTGCTTGTCACGGCAGGGAAGGCCTACGAGC
GCACGAGCAAACTGCCGTTCAGGATCCGATTGACAATGAGGGGCCGTTGTACATGTATCTCGCCCGCGGCGGGCCCCGCCGTACCTTACATGCATTTTAG
ACACGCAGCAGACCGGATAGGGGGATGCTTCTTGGGCCTCCTGTGTCTGAGAGCTCATGTCATGCACCAGAAGCCcgaggtgctgcacgagTTGCTGCAA
AGAGGATGGGCGCAGAGCAAGCGGTGCTCCGTCTCGGGCGGCGGGTGGCTGGCCGCCCGCTTCAGTGCAGCGCATCCTTCCTCCTTCAGTTAATAACATG
CGAGGCGGCAAATATCGCTACAGTACTGTATGCACAATGGTGCAATGTGCATGTGTTgccatgcagcagcacaaggcGCCGCTGAGACGGCCaggccagc
agcttgaagacgcgggagtcttcaacgtcaaaaTGGTAAACCGATGCTTGGATTTGCTCGCCTCTGGTTTGTCTGCCACATACACACAGCTCCATATCGT
GTACACGATAGTGGACGAGCTTTCTGCCGGTGCACTCTGCCCCCGACTTGGGTGCCGGGCGTCTTGGCATCGAGTTAGCCAAGGAAATCCGGAGCGCGCA
AGCAGCTGCTGTCATCAGCGATCAGCGATTCTTGCAAGCAGCGAGCGCACAAGGGAAAGAGAGCGGTTGCCTTGCACCGGAAAGGGCCCAAACTTTAGGC
AAAAGTGGGATCGACTGGAGGCAGGTCGCCCCTCGCGTTACAGTTCCAAAGTGCGTTATCCTGAGGATGAGCTGCCTCAGGACCGGCCGTCGCCATTGCT
AATTCCCCTTGAAAGCCCGATTTTCGTCGAAAATTCATCGCTATCATTTCCATTCCGAACAGCAGTACTGCGAGCCCACTGCCTGCGAGCCGCTATTCTT
GACAGCGCAATAGATACGTACCAAGTGGTTGGTTGCCGCTTCGTCCACATGCTTGTCCGACTGTGACAGTCGCTGAGATTGGCGAAAGCGCATCCCGATA
CTGAGACGGTCGAGAGCGCATCCCTTAAACTGAGGGGGGTCTTGCCAAGCTGGTGCCCGCGCTGTGCCTTCATGTGGTGTTCCGTATCTCGCCCGAATGC
AAGTCTCTgttgcaacagcaacttggtgcAAGCAGGGACATGAGCTCACAAAAGCCCCAACATGAGCCGACACAGGCGAGCGCTTGCACGGACCCGGGGC
TGCTCTGCACGAATACTCGCGCTGAGTATGCTTGCCCGGAAAAAGAGCCGCCACAGGCATCGGCTCTGCTCGAGCGCCGTGCTCACTGAGCAAGTGCACT
CTGCACACTCAGATTGGAGAAACTCAaatctgcagcggcggaCCCGAAAAAGAGAACTCGCTTGAGCCGTGTGCTTTAACGCTCTCACTTTGGAATTTGC
CTTCTCCTGGAGAAGTACTGCAAGCAAGCCGCAACAGCAAGCTCGACCTTCTTCCGGTTCCTTCGTTCCTGTCAAGATGTCGACCGCCAACGGCAAgacc
gccttcttcacggtgGAGGACGCGAAGGCGTCCTTCAacctcttctgctgcgtctgcggTATCGGTTC