Description :
From Genome Similarity Track
Location :
Scaffold_1366:1062- 3147
Transcript NameFunction/comments
Phypl_g13229hypothetical protein

Sequence
2085 bases(100 bases per row)
TGTTGGAACGTCTGTCGGCAGCTGCCCTGACACTAAAGCTGAAGAAGTGTGTCTTcgccacgacgtcgatgGAGTACTTGGGCcacgagctcagcagcga
cggtgTGCGGCCGGTGGAGCGGTTGGTGACGGCGGTTGGTGAGTTTCCGCGACCCGTCGATCCGGTCGATGTGAAACGGTTTGTACATCTTGCGGGGTAC
TACCGCAAGTTCATCGAGGCATTTGGTTCTATGATGGCGCCAAGGATGCAGCTCCTCAAGAAGGATACGGATTGAGAATGGACTGAGGACCAGGAGTTCG
CGTTTGAGAGAGTGAAGGCGGCACTAACTACGCGGCCCCTGCTCATCTACCCGAACTTTGAGCTTCCTTTCCGGTTGGTGACAGATGCGAGCACGACAGA
GCTCGGGGCTTGCCTCATGCAAAATCAAGGACGTGGCTGGCAACCGATAGCGTTCTCCAGCAAAGTCAATAGCAGCGCGGAGGCGAACTATTAGTCCACC
ACGGAGCTCGACTGTTTGGCGGTGGTTTAGTCGGTGAAGCTGTTCTGCCCGTATCTGTACGGCAGGACTTTCACAATCATCACCGACCATGCCTCATTGA
AGTGGCTGGTGACGCGACCGAACTTGGCTGGACGACTACACATATGGTCACTTACTCTACAAGAATACGAGTTTGAAATTGTCTATTGTCCTGCAACGAC
GAATGTGGTGGCTGACGCGCTGTCCAGGGCGCCAGAAACGGAAATGAGTACGGCGGCAAGCGACAAAAAGCgagacgaagacggaggacgGGAAGCTGCC
CACGATCTCAATGATCAGGGAGGCCGAGAAGTACGCCAGACGGACGACGGCTAggccacgagcggcagcaacggacaggacgacgacagctgaggtgaca
gcagctcctgtgGTAACTGAGACCGCGACGAGTACGACAGAGGCAGCTACGGACGACGGGCGGCTGGACAGATTAGCAACGACGGCCAATCGGCCACTGA
CGAGAGCCGCCAAGAGCCGCCAAGTAGCGGAGGCAGCGACCACGCGACGAGCGACGCAGAATGCGTCGACTACGAGTGACGACGAACGAGCTACGGACGC
AGGAACGGATGGCTCGGTGCCGACGGACGCGGCGATGTCGGCGATCAGTgcggagcagcacgcgaAGACGTTGGCGGACATAGAtacggacgacgacacc
cTGCAGTCGACGATAGCGGCAGCGAGCCACACGGGCACGAACGGCACGACGGTGCAACACGCAGGACGAGACGAAGGACAGAGTCGGCGGAGAGTCACGT
GGTCGCGCCTTCGGCCGAAACGAGAAACGACGCGTCGGTGGTCACACAGATGACGGACGATTCGGTGGAGTCGACGACGGGCAGCACAATGGAGCAATCG
ACGATCAATGCTGTGACGTCCGGTGTCGCGACGTCATGGAGCACGACGGAGCGCCCGCTGATAGCTCCACAACGGGCCATCAGGACGAACGAAGAGCGCC
GGGCGACAAGAACTGCTCCCAAGGTGCGGAAGCCGAcaagcagcaccatggcggGTGGCACGACGGCAACGGACGAAGCGGACGGACGAGAGAACCAAGT
GCGGATGGACGGATACTTGTAACGCAACAGGAAGGAGCGATAGCAGCTCAGGCGATGGTAGACGTGCCGGAAGACGCGGACAAAGTGGAACCACCGACGA
ACTACACGCTCCAGCGCACAGACGACGAGATATCGGTGGCGCAGCGACGTAGTCGACtggtgcagaagctcgtcgaggCTGGAGAGTATCGATCCATGAC
GTTGGAACGGGCGTACGGGCTGGTAGTCGTGCAAACACAGCACGGCCGGCGAGTGGTGCTGGCACCCTCGATGTGGGCCGTGATGTTCAAAGAAATGAAT
GTGTGGTGTCGGGAATGACCGGAGAACGCCGGCGCCCTCGTCACCACCGTTGGAGGCTTGAGTGTCGAGAATCCCGTTGGGGCTGAATGTGTGGCCCAGT
GCTGATTGGCCCAAAACCCTCGTGGAAGAGTGATGGTCCTTGACCGAACAagtgtgcgccacaccacgaGTGCAACGGCCGGACA