Description :
From Genome Similarity Track
Location :
Scaffold_717:10619- 12597
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_717-fgenesh-gene-0.2Ubiquinone biosynthesis protein COQ9
Pytar_ATCC12531maker-par_contig_717-fgenesh-gene-0.3MORN repeat-containing protein

Sequence
1978 bases(100 bases per row)
ACCCATCTCCATCACCTGGCCACCCCAAAATCGAACCGCACCGTCGAGACGAAAAGATCAGGAGAATGGTGCGCGCGACTCGCCTCGCGTTGCGTCTCCA
GACGGCGGCGCGTGCAGCGCAACGACTCGAATTGACGGCTGCCAGGGCTGCGGCTAATGGCTCGCTTCTCCAGCGCGTGTTCACGTCGCAGGCCGTGCGC
AATGCCAAGCCAACCATCGCGGTTCGCACTATGACCACGACGGCCACACCGCTCGGCGACGACCAGTCGCAGCAGCAGAAGCAGGACCCGTTCTCAACCC
CAGAGACGCAGATTCTCGAGCACGCACTCAATCACGTCGCCGAATTCGGGTACGTTGTTTGTCTCGCCCAAGCGGAGCTGCTCGCCATCTTGTTTGGTTT
TTCTGACCCTTACTACTCCACACAGATGGAGCGTGGACGCACTGGCGGCCGGTGCCAAGGACATTGGCTACCCGTCAGTCGCGCACGGCATGCTGCCGCG
TGGCGCGATTGAACTGGTCGATTTCTTCATGGACAGGAGCTTCGAGCAGACCCGCGCGACGCTGGTCGCCCACACGGCCCAGCTGCAGGCCATGTCAGTG
GCCGACCGACTCAAGTTTGGCGTGCGCACGCGGCTCGAGCTGCTCGCGCCCGTGGTGCACACGTGGCCGCAGGCTATGGCGCTCGGCGCGCTGCCGCAGA
ATGCGCCCTCGACCATGCGCAAGCTCGCGCAGCTGGCGGACGAGATCTGGTACTTTGCCGGCGACAAGTCGACCGACGCGAGCTGGTACACGAAGCGCGC
GCTGCTCACGGGCATTTACGCGAGCACGGAACTCTTTTTGCTCTCGGACGCGTCGCCCAACTTCGAAGAGACGTGGAAGTTCCTCGACCGCCGCATTGAA
GAGACCATCACGCTCGGCGAGCTGCCGCGAAACGTACGTATCTTCTCGATCAGTCACTAGGAGATTCAGGCTGTTGACGAGTATCTATCTGTTTTAACTA
GCTGGAGGACGTGGCGGGCATGGTCAACATTGGTGTCCAGTCGTTCCTGTCGGCGGCCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGGTCCG
CTCGGCTCGCAGATCGTCAAGAGCTCGCCGCTGGGCAACGTGCCCAACCCAATCTCGGCCATCGGCAACGTCGTCGTGCCGCCGTCCGTCGCGGCCGGCC
TTGCGTCCACGGGGTTCCCGCTTAACCCACTGAGCGGTGGCGCGACGCCGTCGCCGTTCCCGACCAGCAGCAACGACTTTGAGCCCAAGGACCTGCGCGA
GATCGACCAGGAGCTGGAAAAGCTCGGCGGCTCGGACGCACGTCGCAACTGATTGCTGCTTCAGTACATTGCGATCCATTGATGGTGCCCATGCCAAAGA
AAAAGAAAGAATCAATACGATATGCTCTTTAGTGGTCTCTCCCATTCGCGTCAGGATCTCCTCCGAGTTCTTCTTCCTCCTCTTCTTCCTCCTCCTCCTC
CTTCTTCTTCCTCCTCCTCCTCCTCCTCCTTCTCTCCTTCCCGTCAGCGTCGCTTCCTTCACTGGCCTCTTCCTGGTCCTTCATCTTCCGCTCTATGAAC
GCCTTCTTCGCCGCGGCCTCGGCCTCTCGCTTCTCCCTCCGCGCCTTCTTGAGCCCGACAATGCGTTCCTCTTCTTCTCGCTCGAGTCGCTCGGCCTCCT
TGTCCCACCATGCGTACTGCAGGTCCTGCACGCGCAGATCGTCCCGCACGCGGAGTAATTGGCGATTCCAGTGCTCTTCCTGCTCGACCGCACTCAACTT
CTCGCGTTTGACTAACCGAATCGCATCGCCCAGCAGGCACAGCGGCCACTGCTCTTTAAACACGTCCGTCTTGTCGGGCTGCGTGAGCGTGCCGGGCCCA
CACATGCGGTTCTCACGCCAGTACCCATTGTACGAGTACCCGAGGGCATTGGTCTCGATACCCTTGCCGTGGCGCTTG