Description :
From Genome Similarity Track
Location :
Scaffold_94:106150- 108385
Transcript NameFunction/comments
Physo_141109hypothetical protein

Sequence
2235 bases(100 bases per row)
CACTACACCTAACTCACATTTAACATCGCAGTGAGCTCCAAGCTTCCACCTTGGGTAGATCGAGGAACCCATAACAACAACGAACCACCCCCAGTGCCAG
GAAGACCAAGAAATCCGGGCCGCCAACGATCCAGATACAGCGTCTTACCCGCCAGCGCCGTCACATTTGACTTCCACGTCACCGTTTTTCCTGCTGGAAC
GTCCACTTCGTCTATTTTGTCACCACCAGACTTGATATTCACAGTCACCGCTTCGGTATCGACACTTTTGAAAGTAATACGCACAGACCCATCGCCAACT
TTCGTCCACGAGCCGACACTGTTGTTAAACGCACGCTGCACGATCGACATTCCCAGCGCCTTTTCAGCATCGCCGTCGTCGATTTCCCCGATGAACTCGG
TGGGCCCGCAGATCGGTTGGAAAAACTCGGAAAGCGCGCCAGTGAAAGACCACGGATCCCAAATCGAGTAGAACGAAAACGCTTTGTCGGCAATTTTGAA
AGCATACTCGCCGGCGCTGAGATACGTCCCATTGCTGCTGGTTCCCGAGCTGATGAGATCGTCCACGATGCCTCCAAATGTTTTTCGGAGCGTATCGCGA
GTGGCAAAAGCCGTTTTCTCGTCCGATTGAGCGATCAACTCACTCATGCAGTTGTTTGTCGCGATGGGGATGTCGTTCAGCACGAGATTCGACTTACTTA
TAGCGACGCGAATGTCGTCCTCGGACATTTTCGGGTTGTGTTTGCGAAACTCTGCGATGGTCATCCACGTGCGATCCAGCAGTCTCTTCATGTCGTACCC
GCAGGTGGAGTTTGACTTCAGCGCTGACTTCAATGACTTGATATCGGTCTCTTTCAGCGACGTGATGGACTCTCCAAGCGTGATATTCTTCATGAAGCTG
GTAAACTTGTCCCAACTAGAAACGATCGTCGCGCCATTCGCGATGACTTCCTTCAGCACATATTCGGCAGTCATTAGCACACTATCCGCGAGCTTGAGCT
CGTCCGACGCGTAGCTCCCGATGCAGTAGAAGACAGCGATGGGGATGTCGACAACAACGTTGTCAGTCTGGTACAGAATCGCCAAAAGTTTGTCTTGAGA
CGTCTGCGGATCAGTCACTTGGATGTTACGAACATACTTGGCCAGCGACTTGATCAAACCCATCATATACTTGGCACACTTGATAACCACTTGCACACCT
CTCGCCAACGCCGCCAGCTTGCCAAATACATCGTACGTGATGAGAGATAGAGTCGTTTGCGCCAAAGCCGACACTTTAGTGACGATCTCAAGCCCACAGT
CGTCGTTTTGTCGAATGCACTCCAGGCCACACTCGACTGGGTACGCGTACGGACACTGCGCCCAGCATGTTCCAAGCTTGTCTTTGAACCCCAATGGACA
CTCCTTGGCGATGTGTGCTTCTCGATAACACGCGGTAGCGAAGGAAGTGTCGAGAGCGGAGCCTACCCAGTTCGCGTACGTGGGCCGAATCGTGCTGGTG
GCATTGATCACGCTGCCTATCGATAGCGCTGCTTCCACAGACTTCGATAAAGCGGCATGGCTGTCGTCGGATGAGTCATCTACGCTGTCTGAAGAGTCGA
GTGAAGGCGAGTTATGCCTGGCGCTGGGCCCTGAGCTGTCGTCGTCACTGTCCAAGGAGTCTAGAGAGTCGTCGTCACTGCTTGGAGGCCTTAAAGACGA
CGTCACAGTCGCTGCTGGTGTGTCATTCGCGGCCATATTGATCCTTGCGGACACCGTTGCGACTGGCGCTAGTCGAGGCGGCGCCATCGAGACCTTGCTG
AACGTGTACGTGCTCGCAGAGGAATCAGTTGCTGCACACGCTGCCGCGAAGACGGCGAACACTGCAATCCATCGGACGGTCATGACTGTGTAGAACACGG
CAAAACGAAAAGTGAGCTGGGTCGACTACATGCACTGCACCGTCAGCAAAGGTCTTTCTTTGCGAGCATTGGGCTCGGAGTTTAAACTCTAATGTCCTCG
ATATATTATCGCGTGCGTGGCAACAGATCATCGGGACGCGCTTCTTCCAATCGCGGGTGGCTTCAGCTTGAACACGGTGCAGGGCTTTCCCAAATTGCCA
TCTGGTTTCGCTGTGCGGTCCGAACACGCCATCTCCGCCACTCACTCGGCAGGCAAATTGGTCCGGAAGAGAATCTTGCTCTGGCCAGAGACACCTCGGT
CTGGGACGTTTTGTCTGGTGGGAAGCGGGTGAGGA