Description :
From Genome Similarity Track
Location :
scaffold_687:10615- 11853
Sequence
1238 bases(100 bases per row)
ACAGATCTAGAATTCGAAATGGCCCTGGAGCAGGCTATACGACACGACATCTATGAGCTCTCGCAAGCGCAGCTGGAGGCGGGCGTCACAATGTGGCCGC
CGTGAGCAGACCTATCAAAGATAACGTAGGTGCCGGTCCTTAGATCGGCTTAGGTTATTAGGATTCTAGGAAGTAATTCAATATACCTCATCACCATCTA
GAATTCGAAATGACCACATTGCGGGTCAGTCAGTACACACACATTACCCTCGATATTCTAAAGCACGACTACAATTAGCCGATTCAATAATTGCCAGTAC
CCCTTTCCGCTGGTAGGGTTTGATTCGGAATAGGTTTATGTGGAGAAATATGAAGGCCACGAGTTCCAGGTGCGTTTCAGCTGGACGAAGAATGCGGTGG
CCATTTGGGACAACCGCTCCACGTTCGACTACCTACCCGGCAACCGCCACGCGATCCGAGTGACACCGCACGGCGAAATCCCGTACTTCGACCCCGAGCG
ATGGCAAAGTTAAACAGAACTTCGTATCGTTTTCTAAAAGAGTCTTTGTCGGCTCGATTGTAGCAAAGAAACAGACCGTTATTGTAAAACAAACCAAAAA
GGAAAAAAAAATACGGCAGCCAAAGTTTAGTTGTAACTCTACAGTTCGTGCGGCTTGAGAGGAATGGTATATGTATAGTTTTACTTAAGTAAGCGTTAGA
ACGTTTAGATGCATTTGACTTCATTCGTTTCCTGAAAGTGAATGTAACAAAGCTTGTTAACAAAACAGGAAATTTAGAAATTCTTGTTGGGGCTGAAGCC
TCACCATCTATCGGGTTCCTAACTGAATCGACAAGGATCCCGAGTATTGTAAGTGCGTTGAACCTGCATTACCAAGTTCTTGTACCGCCATGCGAAGGAA
TTTGGAGTTGAGTAGACAAGGTTCTCCAACTTTTGGGATTTGATACACCTACTTCAGCAAATTTGCCACTACCCGAACGTCGAATTTGAATTCCTCGTCC
ATAGGATATAGTCATTTTCATTAGCAGGCGAAACGAGTAGTGTCTAACTAGTTGATCATTTTTTTTTCCATTCAATAATAAATATTGCAATTATTTCAGT
ATATTGCAGGCCTTGCAGGAAACAGTTAAACGGTCTGTAGTGTAGGTTAACCTTACCATGCCGGCACACAGGGCTTAAATCCTACCGCTACAGAGAATTG
CAGGTGACTGTCAACCTAGTTGGACAATTTTAAAGAAC