Description :
From Genome Similarity Track
Location :
Scaffold_105:106145- 114170
Transcript NameFunction/comments
Physo_141914CRN-like CRN9
Physo_141915hypothetical protein

Sequence
8025 bases(100 bases per row)
CAGCACCACCGGGCACCTGAATGTTGCAATCTGCGACTGGTGCCGCTCCCGAACTGATCAGACTTGCTCCCACGGAAGTGTATCACTACCGCAGGTACTT
CTTGTAGATTTTCGACTTCTTTTTCCTCGCTTTTCACAAATTTCATGTCCGAGCGTCGAATCGCGTATGACTTCACATTTGAGGCAAGCGTTAGATATTC
AGATCGCCTCAAAAGAAAGAAGAAGCCCAGCACCGAAGCCCCCCCCCCATGACTCGGTTCTGGGTTGACGAGAAGTCGAGTGATTCGTGCAACCGTTTGA
GGATAGTCGCCGTAACTGGGGATTTTGGGCTGCCGATTGGGTCTGATCTTCGCATCTCAGCGATTGCGAGCTGGTGGCCGGGCAGTAGTTTGACGCTGTA
TCCGAGTTATCGCCGATGATGCCACGAGATCTGACTAACTTTTGAGAGCACGGTACCGGCAGTGTTTCCAATGGCTGATTTACTCCAGCCGAATCTCCAG
CAGTAAACGGCAAATGGGGCGAGTTGATAGGAGTGCTGGCTGGGGCTTTCGGGGAGCCATCTTGGAAAATTAAGCCAGTCACACCATTGACACCACTGAT
TCCAGGTTGCGTTATAGTTTGATGCCGACGCCGCGGCCACTGAGCGGGACTGAAGTTGCTCAAGAAGCCCGTGTAGATTTTCCTGCAATGCGCTGGGACT
GGAGACTGTGTCCAACACGACGAAAAGTTAGTCCATCTTGTTAGATAGGGTTCGGCCCACGCACGTGATGCGGCATCCGCCATCCAGTTTGATTAACCCG
CGATGTGCTCAGCAGATATCCTGAGATTATAGTACGCTTCCCCAAGGCCGATGCACCTATTTATTTCTTGGCTGAACTGGTTCCTTGCGTGAAGTTTGTT
GCACCAAGTGACGACAGAGGTGTTGTCACTCCAGCATCTCACTTGCACCAGTCGACCAGCGGATTGTCTGTTCCACGTTGGACCCCACGTCCAGAAAGCC
ATCGCCATGCACAAGTATTCCCTTACGTTGATAGAGAAGTCGGCTTCGGACGACAACGACTCCTTATTCTCATTTAGTACTGTAGTGTATGATACAGTCT
GTGTCTTTATCGCACCATGAAGATGGCTCCCGCCTCTCGGCGAGATCCTTGAATTAATGTAACGTAGGCACATTTATTTGGCGGACCTTCATCAGAAAAC
TCCTCGCTCTCGATAAACCATGTACATGTAACTCCGTCAAGTACGCGGCGCTAGTTTTAACATCAGCGAAATGGATCGTAGCAGCCCATGAGGATTTGGT
ACGGGCGTAGAGTAGCAGCTTCTTACAGTATTAACGTCCCCCTATGCTCGTTGACGAATGTTATGCTACAGCCAGGAGGAACGGCCTTATCTGCGCTCGC
ATGTTGCTACACGTACATGAACTACACTTATTTTTACGCTTTTCATCACGAAGATTGTCTCTCCAACGTAATTTCTCATTACGAATCAAAACTGCATAGT
GAGATCAAGTCAGCGAAATTTAGTGTTTTCACAGCATAAATTGTGTGCTCCACGCCAAATCGAATCTGTGACGTGTGAGAATCTGGGGTCATCAATCAGT
CTTGAAGTTGCTGGCCGCGCGCCATGCCAACTCCCACTCATTCCGCAACTCGCCGCGTGCCTTTCACGTCCAGAAGACGAAGAAGAAGACGAAGACGAAG
AAGAAGATGGCGAGGCTGCCGACCCCGGACCCTCTCACGGCCGTGACGCTGGTGTTCCGTTCGCGCTGCATCCACGCCTCCGCCGCCCTACGGCCTTCCT
GGACGCTGCAGTGGAGATGGAACTGTGCAAGGCCTGCACGTTCAACTCCCTCCGCCTGCTGGACCGCATCTGGGACTCTTCGCTACCGGAAACGCACCCG
TCTCCAGCGGAAGTGGGTCCGGGCAACGGGGGCTCGTGGACCCGACGCAAGTATCTGCGCACGGACCGCCACTACCGCCGCTTCCAGTTGCGTCGCGCCA
TCGTGGAAGCTGTCAAGATCGAGGACGCCAAGGCCGCGCTGCGGATGGTGCAGTGGCTCTGCACCAAGTTCCACGGCTGCATCGTCCCCGTCACCGCCGT
CCACACAGCTGCGGGCAAAGGGAACCTGGACGTCTTGAAGTTCTTCAAGGCGATTGAGATCCCTGGGAGGAGGGACGGAGGCGCAGCCATGAGGGACGAG
ATCGAGAACGACAAGGGCCACGTCGTCCGTTGGGGGCGTCACGATATGGAGCACGCCGCTGCCAATAAGCAGTACGAGACCACTACGTGGCTCTACCAGA
ACACTTGCGCGCCTCGAGCCATGAAGAGCACGCTCATGACGGTGGTGCACCACGGAGACATCGCGCTGCTCGAGTGGTTTCGTGCTAACTATCGCACTCT
GGGGTTCGACCCGGACACGGAAGAGGAAGAGTACGAGCTGGCGGAAGCAGATCGTGATCGTGAGGACTTGGACTTATACGATGAGTTCGGGTTCGGGAAC
GAAGGAGCGCTGACGGGTGAAAACGTGGGGGAGCTCCTGCGAGGGGACCCTGAGGAGTTCATACGGACGGCAGTGTTTGCCGGTCGTCTTGACGTCTTGA
AGTGGATGGTCCAGAATGGCTACGTGAACAAGTCGACGTACCTAGCGGTTCGCCCCGCGGTTGAGACCAATCGCCTCGACATTGTGGAGTTTCTGATCAG
CAACAAGTTGGTAGAGGCCGGTCGAGCTCTGAGGCTGGATATACGGGGGCAAGTTTGACATGGCAAGACAGCTGCACAGCAAGTACTGGACCAGCATCGT
GTCGGCGCACTATTATCCAGTGCAATGCCCGTTCTCGAAAAGTGATCGTGATGCACTGTGGGTCTCACCGAAAGCCATGATCGCAGCGATTGAACGCGGT
AACTTCGAGTCTGTACAATGGCTGGTCACCACGTTCGGCTCCGAATTCAACTTGTTCGGTGCTAGCCAACTGAGTTTGTCGGAGAAGAAAAGGATGAGTC
TTGACACGGTAGCGCGACGTGGAGAACTTCCACTGCTCAGATATTTACACAAAATATCGGTCGGAGCCATCACCACCACCAAAACCAACGGACAAGCCAA
GAAGAAGGCAAAGGTATCGCGCAAAACGAGCCTGGTATGCACGACTGCAGCGATGGACCAAGCTGTTGCTAATAACCATCTCGAAGTGGTAAAGTGGCTT
CACTCCAAGCGGACCGAAGGCTGCACGACGCGAGCCATGGACCTCGCGGCAGCAAATGGGCACTTGCAGATGGTGAAATGGCTCAGCACTCACCGGTCGG
AAGGGTGCACGGCTGCGGTCATGGATTTCGCAGCGAGCAGAGGACACCTGGAAGTCGTGGCGTGGCTGCATCACAATCGACCCGAAGGATGCACGGTCAA
AGCTCTCATTGGGGCGGCTCTAAACGGCAATCTCGAAGTCGTCAAGTATCTTCACCGACAGGTCAACGCTCAGTGCACGGCGAAAGCAATGGACGCTGCT
GCCATCAAGGGCCACCTGGAAGTCGTCAAGTGGCTGCATGCAAATCGAACCGAGGGCTGCACAACCGCTGCGATGGATGGAGCTGCTCGTAATTGCAAGC
TGGACGTCACCAAGTGGCTCCACAAGAACCGGTCGGAAGGCTGCACCACTGCGGCTATGGACGAGGCCAAAACGTTGGAGATCGTGCAGTGGTTGCAGGC
TAATCGAGTTGAGGGGTGCACGACCAAGGCGCTTGATCGCGCAGCTTCCGATGGAGACTTTGACCGCATATTAGTAGTGGGTCATGGAACATTACGCCGG
CAGTTTTTTTCCTTACCATAATTTACCACCGAGAACATTCCTGAAACCTTCTTTCGGGACAGCAGCGATTTCAACGACGACCCCTCTCGACCACTCGAGA
GCGAGAGCCACGTCTTTTCGATATGAGGGTAGTTTTAGAACCTCTGAACCGGTCAGATCTAATAGACGTTGATTTGACGACGCCCACTTTATAGCGAGAG
CCACGTCTTTTGGACCTTACGGCGTTTCGGGACCGCTCGTTCAAACCACATTGATAAACCAATAGAACATTACGCCGGCAGATTTTACTAGTAGTTCGGA
CCAGCGCGACGTGGCGTCTCATCATTGGTTGAAAATCTATGTCACACACCTTCATGTTCGCTTAAGTACGCCAGAAATTCTACCTCCTCATTCCAGAATC
TGCCGGCTCGAGGAAAGATGGTGAAGCTCTTCTGCGCGATCGTTGGCGTGGCGGGCAGCGCGTTCTCGGTGCGAGTGAATGAGAGCGACACGGTGGACGA
CTTGAAGGACGCGATCAAGGCGAAGAAGACGAACAAGCTGAAGGACATCGATGCATGTGACCTGCAGCTCTTCCTGGCGAAGACGGAGGGCGGCGCGTGG
CTCGTGTCCGACTCAGAAGATGTGAAGAAGCTGAAGAAGGGCGAGAAGACTGTCGCAGTTGAGGCTTTAACAAGCGAAGAGAAGGAGCTACAGGGGGAGT
CTGGCCTGCAGAAAGTGTTGAAGGGCATGCAGAAGCCATCAACGGACCAGATTCACGTGCTGGTGAAGGTTCCTGAGCAAGAACACGCACAAACTGGATT
GTGGCTTGTCACTGGATCCGTTGACAACGCGCTGAACACGAAAGGGATTCGCTGCAAACTGTACTGGATGGCGACGTTACGCATTGGATACTACGATCCT
ACGCGCTGCATCGGCAACAAGAATGTCGCGTTTTGGTATGAAGACAAGAAATTGTGTTTTCATGTTTTATTCGAGACAAGTACGTGCTTCTATATGCTGT
CGCTGCATCGTAATACTGCTTCATTGAGGGCTAACTCTGTTTCTTTTATAGAAGATGCTGCTTTGCTGTTCGAAACTGACTTAAGGACTGGGCCACAAAC
GCTGGGCTCTCCGTTAACTAACCAGGTTGTTGAGACGCGTGTTGCACCAGCTAACGCTGTGTCTACTGATCTCCAGCGCGTCTTCTACTGCGACTACGTT
CCAGACGATTCGGAATCTCCTCAAAACACAGTTTCATCGATATCGTTGACTACAAGCGTTTCGAATCTGGACTCATCGACTGACGAGTTTCGTTTTCAGC
GGATTGAGGACGCGAAGTTCTTCCTACCGTACGGCAAGGCAGAAAGCTGCCATTTGGTGTCGAGAAAGCAAAGCAGAGACCACAAACGGGAATTCGCCAA
GTACGATCGCGACTCAAACAACAGGCTTGCGCTTTCTCGCGAAATGCATGGTTGGTTCGACGGTATGAGCATTGAGGTTCCCATCGTCAACATGCTACCC
GGATCTGTTGAAGAGAATCAATCCATTGGCAACAGACGCAAGGTACTGTGTGAGCGCGTAGTTCTGGTGTGTGTAAGTTTACTGACATTTGCGTGTAGGT
CGAGGTCTTCGTGAAGGTTCTGGATGCTCAGTGCACAGATCGCGTTTTCAGTCGTTTGAAAGGAGGATCAACCACGACGGACGATCCGCTCATGATGAAG
ACGTTTGTTCACGTGGAGGATCCAGAAACATTTTGTTTGTGCATGAGGTGGAAGCACGACGATAATGCGGAGCGTTGGAGAAGCTTTTGGGATATGACTC
CTGCGGTCGATTGAATGGAATAATGTGGCTCCCGAGTTAAATACTTCGAAGTAGTATTTGATTTCTTGACATACTTTGATCCTGATAAATATAAAGTTAG
TAATATACAAAGATGGCGTACTCTCCTGAGCAATACCAAGCTAGCAAGGAACGAATCAAAGCAGCGCAGAAGCGCTACTACCAGCGCACACGCGAAGCCC
GTTTATCTTATCAAAAAGACAACGATGACAAGAACAGAGACCAGATTCGAGCTCGCAAGCGTAAACCCAACACCGAACTTATTGATGGTGAAGTCGAACT
TAATAATGAAACCGAACTTAATTAATTAATTAATTTTTTTCCTCGGATAAAAAGTCGCCTATGATATAAAGTCAATCCTGATACAAGACCCAATATTATA
AAGTCGTTTTTTCGGAGAATAATATAGCCACCGATATATAGCAATGTTCGCATACGAGCTTGAAGGTCTTAAGAGATTAAATATTAACCCAATCCGATGG
GGTAGCAGCTACCGTATTAAGGTACGTGGCAAGACGGGGCGCATGGTATACATTAGCAACATTTCCCACCCCATCAACCAAAAATTTAAAAATTTATGTG
TTTTAACTGGACGTTCTAAAAGTATTTATCGTTTATTTAAAATTTCTAGTATTACATTAAAACTTTTTTTTACAAATTGAAACTATAATTTATTGAATAA
TTATTTTTTTTATTTTTTTACGAGTAGGTTTTCCTTTAGTTTTTTTCCTGTTTCTTGTAAACTTTTTTCATCTTTATATTTTTTAATCAAGAAATTCATT
AAAAGCTATTTTTAATGTACATTCTAATAAAATTGTTTAATAGTGTTTATTAAATTATTAATCTTATTTTGAAATTTTTTTAACATAAATTAAAATTAAA
AATTTCAGAATATGGTCTTTATTTTTATAATTTTTTAAATAGAAAAATGTATTTTGATAAAATTAAAAAAAACATTTATTTTAATAAATATAATAAAAAA
GTTCATACGAGGAAAAGCCATATCTGGAGCACCAATCATTAAAGGAAATGACAGATTGATTAATAAAAATGGAAATCATTATTTATGAAAAACGATTTAG
TCAATTTTTGGTTTTAAAATAAATAATAAACTGATATTCCGTATAATACCAAGCATAACATTTTTTTCTGAATAATATTTAAAATGATGTATTAAAGATT
CCATAGAATTTTTAATTTGAGTTCTATTTGGATTTGTAATTTTTTTAGTGTATATCATTATGATTTTGAGTATTTTTGATAATTTTATTAGAATTAAAAA
AAATGGACCTTTATATTTACTTCTAGACATAATTTATTGAATAATTAATTTTTCCTAAAATTGGTAGCGAAGCAGTACAAGATCAGTCTAGGCAAGCTCC
AAAAGAATTTGGCTGCTGATTTCAAGGAAGACAGTAAGTACCGCTTCTACCAAGGCAAACACATGGAGTCGCACCTATATGAGGGAATCCAGCCTGCTGA
CTTCTACGACAAGCTTGAGAACGTGCTTGCAACCCAGAAGTCTGCCTTCAAGGTCAACATCGCTCTTGGATACAAGCTTGTCAGCAGAACCGATGACAGC
GAGACTCGCTACTTCCACCCGAATATTAGCAACACGTCTGTATTTAGCACTCCTGTAGCTATCAACAGCAAGGCTGATATTCGTAAGAAGGTGATCTCGG
AGATTCGCTCCATGGAGTTGGCTGACAAGCTCAACTACCCCAGCTCCGGGTACATGGTGAAGGGGATTACTGGCTTCAAAATCTATATCTACCAACGCGA
CCATGCTCTGGGTGATAGCGAGGCTGTCATTCCTAAGGCGATTCGTAATAACAAGCACGTCATCAACTTCCCCAAGACGAACAACAAGTGTGTCTTCCAC
TGCATTGCTTATCACAAGCAGGAGGGAGCCAAGAAGGATCCTCGTAGAATCCAGGCTCTGGTGAAACAAGCCTTCAAGCAGCACTGTTCGTACAAGGAGA
TCACCTACACTCTGGGTCTGTTCCGCAATTTCAAGCCTATCGACATTCTCCAATTCGATGAGCTTGAGGAGTGCTTCAAGCTGAACATCAACGTCTTCAA
CATGGATGTTGAGACGGGCAAGGTTGAATGCATTCGCTGCTCGGACAAGGACTATGATTCGATCAACATCCTGTCGCACGAGAATCACGCTCTCTACATC
ACGAACGTTGATATGCTCCAGCAGAAGTACCAATGCTCTACGTGTGAGATGGTGTTTGTTAGCTCTGATAAGCTACGTAACCACAGTAAGAACCAATGCG
AACTCGTGAACATCGAATCGTTCCCAGCTCAGCCAACCATTTACCAACCCGCTCCGAACAGCATTCGTTACATGCTGACTAAGTACTCCATCAAGGATGC
TGACCATTACATCGATCACTTCATT