Description :
From Genome Similarity Track
Location :
scaffold_16:10614- 11654
Sequence
1040 bases(100 bases per row)
TCTCTAAATTCGGGCAGGCTTAAACCATGCCCAGTCATAACTTGCGCTCGAACAAAGTTGCTCGACGCACCAGTGTTAATCAAAGCTGGTGGTGGTTTCT
CAACCATTTACAAAGACCTCTTGGACTATCAAAGTCACACTTTTCCTGAGACGTCCATCACTCATAgtggaaactgcatgtgcatcGTGCACATTGGGGC
CAGAGTTCTCTCTATTCACAGCATCAACAGTTCTATATATGGACCCAGTTGGGAGCCCTGCCCCTATTGGTCGTCCCAATTTCTTACCCTTGCGACTTCC
GCGGTTGATCGAACGAGAACCCCGTGTCTGTTGCCAACACTCTGCGGTTCCGGGAAACATGACTCAGCTTCTCACAACGGAAGCACTTTCCATCGTTGCG
AGGACGCTCATTTCCAGGCGTGGAAATGTACGAGAAGTCCATTGGTATTGGACCATCATATGTACCGATCGACTGGCGCGCTTGCCTTGGTACGAAGCCA
TTGAAGTTGGTTTGCCTTATGCTGCACTATTCTTGCGTCGCACGGTTGATGGCATCGTCCAGGTCTTGGGATACTCATGGAACAATTGATTCCGAATTAA
ACCATCTTTCAAGCCTACCATGAACGTTACAACTTGCGCTGAAACGTCAATTGGTTCGTTGACGATGCTTGATACCAAGTAGCGAGCACGCTGTGCATAC
GAGTGTAGGTCGTAACAACCGCTTCAAGAACTCGTCACGGGCACGAAGCTCACTCTGTGGTGGTTCAAACGCCTTCTTTAGCTCGACTTTGAAGCGTTCG
TAGCTAGAAAAGCAGTCTAGATCGTGTAAACGCTTCTTATACACCCAACTCTTCGCACGACCCGCAAGGTTGGACATTGCACTTCCGGCAAGGGGTCTCG
CAACTGtcttgcagtgattgctACATCCAACTCGACAAACCATCGTGAGAGAAGCTCGTTTATAACACTTGCGGCAAGGGGTCTCGCAGTTGTCCtgcag
tgattgctgcatccaACTCGACATCCCATCGTGATAGAGG