Description :
From Genome Similarity Track
Location :
Scaffold_1070:10613- 14475
Transcript NameFunction/comments
Phyta_totarag11936reverse transcriptase
Phyta_totarag11937hypothetical protein

Sequence
3862 bases(100 bases per row)
GACAAACAAGTGTGCATTAAGGAAGGAGGTAAGCTTTATGCAGAAGATCTCGAGGGCTACAAGGCGGTATTGCCGGAAATCACGCCGACGACGGAAGAAG
TAAAGATTGAAGACATTCAGATGGGGAATCCTGAGAACAATACGCCGGAAGAAATCGAGCGACTGGTGGAGATCATATGGCGCCGCCGACACCATTTAAT
CGGGAAAGGGAACGCCTTGCCGCCGGCTGTGAATGCAGCGATCTGCGACATTGATGTGGGAAATGCAAAACCACAGTCCAGCGGGTCCGCAAAGTCGTTC
CACAGTTCCGCGAGAAGTTGTTCCAGCTGATCAGGGGATTGCTGTCAGCCGAGATTATCCGgcactcgacgtcgccatgGGCGTATTCAACCGTCgtgat
catcaagaagaacggagTCGACATCAGACTCTGTATTGAATACTACCTGATCAGCAGTCTGATCCGACTGATGGTGTACCCTGTGACGCTTATCAACGGC
CTCCTCGACGATCTTGACAAGATCCTCTGATATTGCTCGTTAGTCATGGCTAGTGGATTGTAGTGGTCTCTATGGCTGATCGAGTGCGTGTGATCTCGGC
GTTTATTACTACGCTCGGGCTGTTCGAATGGAATCGAATGCCATTCCGACTGAAAAACGCGCCGCAGATTTACCAAAGACTGGTGGACAACGCGCTGTAT
GGGTTCCTCAAGATCACGAACAACCAAGATCACGCCAACCAGGCCGACGCATTCGAGGAGGGGGAGCCTGTCTTAGAAAAGGAATCGTCGGCTCTCGGTC
GTCGAGCTTACATCGATGACATCGTTGTGACGGTAGATTCGTGGGATACGTTGTGTGAaaagatggagaagctgctggacgcctgCGACGAGTGGTATTT
ATCAATCAGTGTTGTCAAGAACTTCTAGGGTCTACGCAAGATCGACTACTTCGGCTATCAAGTGTCTGATGGCGGACTGGAAGCTCACCCGAACGATCTG
TTATCGCTGACTAATTTGCCATTTCCGCTTACGCTAAGCTCAATGCAGCCGTTTTGGGGGAGACTCAACTAGTACAGTCGCTTCATTGAGGACTTCGCGA
TCTACGCGTCGGTCCTGTATGAGCTCCGAGAGGCGGATTTCTATGAGATGGCACGAAGATCAAAACTGGACCCGGCGTCTGGACAAGCCAAGGACGGCGA
AGATCAATCCACAGATGACAATGAAAAGTGGAGTCGAGCTGTCACAGCCTTCACAGCactgaaggacaagatcgCTACAGCACcaatgttgcagcacttc
gatccagatcgaagaccggtggtggtggtatATGCGAGCAAGTGGGCAATTGCGGCCGCGTTGATGCAAGAACATGGGGGCGTATAGAAACCGGTAACGT
TTACTAGGCGGATGCTCAAGCCTAACGAGATCAACTACAGAATCGTCGATAAAGAagttctcgcgctgctccgGATTTTGGATGTCTGCTACACACAGCT
AGTGACGAGATCAGTCAAGGTGCTGACTCGGCACTCCGCGTTGGCATAGCTAGTGCACTCATCAGGATTGCAAGGACGACTCGGTCTCTGGGCcgcgttg
ctgttgagctGGACcctggagatcgtcaagtGCGACAAAGGTGAGGACTAGATCCTGGGCACAATAGCTGCGAGCATCACACCATGTGAAGAGATCGACG
CGATCTTCGTTTCGATAGCACCCAGAAAGCAGCCCCGGCAGGTAATTACCATGCCGCCACCTACGGTGGAGGCGGATGTAAAGTTGCTAGTGGTCAGCTT
CAATGGATCAGCTCGAGTAAATGGAGGAGCGTATGGAGCCATTGTGTGGAGCCTACCCGAATGGAAAGTGatctcagcagcgtcacagTACAAGGACGAT
TTGACAGCCAACGAGGGGGGATATCATGGTTCACTCCTGTGCTTCGATCTTCTGGCTGACCTGGACAGGGGACGGCTAATTATCTGCGGAGATTCGAATT
TGGTCATTCGACNTGGCCAAGTCACGAATTCCTTCATATGAAGCGAGACTGGAACCAAAGCGCAGATCAACTCGCCGGCGCCGCTCTTAAGCGTGATGAA
GGCACGGTAGTGAGATCGGAAGATGAGTTCGAAGACTTAATGACACTTACCGTCTCGACGAGATGCTAGTCCCACGAGCTGACAGTGCTGTCATCAAAAT
CACGGCCGTAACGAGGTCGCGCAAGCGGCGCAGCCCAGAAGTGTTGCAGGAGGAGATTGTTAAGCGAATGAGGGAAGAGCGAATATGCATGGCACAATAC
GAAGAAAAGTGGATCGTCGATCTCAAGCAGTATTTGCGTGGGGACGTACAGGAACTTGCCTCATTAGAGGCGAAGACCTGCGCCAAGATTGCGGGAGATT
atgagatcgacgagacCGGCTTGTTGTTTTACTGCCCGCCGTCCAAACACTCGAATGAGATCGCGATCGCGTTGCTCGACTGGTGATTCCTGAGACGCTA
CAAGAAGGCTTCCTACAGCATTACCATGTCAGTCTGGAATGTGGACATCAAGGTATCGGAAGGACGCACCATCCGATCAAGGCGCATTTCCACTAGAGAC
GACTGTCTCAACGTGTGCAACGTTACGTGGGTCAGTGCATAGACTGCGAGACTGGAAAAGCGAGACCAACTATTCGAGGTGAGTCACAGGGCAACCTACA
TGCGACATATCCATTTCAGAGCATCGCTATGGACCACATCCCGTCGCTGCCCCGATCTTATAAGGGCAACACGGAATTGTTGATTTGAGTCGATCTCTTC
ACCGGCTTCGTGATCGCCAAGGCAAGTGCATCGAGAACTGCTCAAACGATTGCGGAGAATTACGAAGAGTGCGTCTTCAGACGATTTGGTGCAAGCGAAG
CAATCCGGCACGATCGAAAGCCAGGCTTCATGTCTGACTTTTTCAGATCGTTCAACAAGACCATCAGACAGCGACAACGAGTGAGTATGGCGTATCGGCC
ACAAGCAAATGGTACAGCTGAACGGATGGTGCAGACGCTAACGCGAGCACTGAAGATGTACGTCGCAGACGTCAACCAGAAGGATTGGGACGAGTACGCA
GAGCGCCTCACATTTGCTCGCAACACGGCTCACGATCGAGTGCGCGGCGACACGCCTTTCTATTTGGCGCATGCATGGGACCCCAGATCAACGCTGGAAG
CGATGATCCCGTTAGGGTCGACGAGGCGCAGAGATCGCAACCCTCGCAGGTGGCGATACCATATCCAGAAGCATTACTAACAGGCGTGTGAGCAAGTGAA
CGAGTACCTGCGTGAAGCTACCCAAACCAGAGCCACTCGCCATAACGAGTCCGTGCGTCCGCACGAGATCGAAGTCGGCAGCCAGGTTTGGTTATACCTG
GACAGGGTGAAGGAGGTCTACGCACGGAAGCTAGCACACATGTGGCACGGACCATTCAGAGTggtcgagaagatcgacgagcaCGCCGTGCGACTGGAGA
TCGCGGGCACGACGTACAACCTATTACCGTGATCCACGTGTCGAAGCTTAAGCCCGTGCGAGACTTCCCTGACCGCCCGCGTCTTCAGCTAGctgtccaa
gatcaagatcgcCTTAATTTTGATGAAGTCCTACTGCCTGAGGATAGCTGGGAAACAGAGCTCGATGATGACGAGTACGAGGTCGAACGCATCACCGAAA
TGCGATCTGGAAGGCGAACACGCTACGGACGAGCGCTACGAGAATTTATGGTGCACTGGAAGGGATACTCTGAACCAACATGGGTGGATGAAGCCGATCT
CAACTGCGGAGCTGTATTGCACGACTACCTGCGCGAACAGGCCAACCGGAACCGGTTTGAGG