Description :
From Genome Similarity Track
Location :
Scaffold_218:10611- 16265
Transcript NameFunction/comments
Phyag_g3607conserved hypothetical protein
Phyag_g3608hypothetical protein
Phyag_g3609hypothetical protein PHYSODRAFT_286623
Phyag_g3610hypothetical protein

Sequence
5654 bases(100 bases per row)
ttcttggcagcttcttctctaGCAATCTGAATCCTGGCCAAATACTGTCCGTACTTATTGCCAAAGATATTGTGGTAGCCCCCAGGCCCCGACGCGCAGC
CTCTGCAGCCACTGTGTTTCTCCTGCACCACCTGCCCCtccgagagctgctgcttgggcaCGCGACAGATGCTGACAGTGCCGTAGTTGTAGTTCTTGGT
GTTGATGGCGAACGTGCTGCACAGGCGCTCGTAGCCcggcttcttccacttggcgATGAGGTTGGCGTCCACCAATTTACGGCGCACGCAGTAGTCGTAC
ACCTCCCGCGGGATCTTCTTGTACTTGTAGAACATGTCGTACACGTAGCGGCTGCGCTGCCAGTTGATCTGGTGCACGGGCCACAGCGCCTCGCACTGCC
GCTTGCCCTCGTGCGGCTCGTTCATCTTCTCACGCAGCTCGCTCTCAAGTGCGTCCATCACAGGCTGGATGTACTCGTAGCCTGCAGGCGCGCGGTTTTT
CTTGCTCCACTTGGACATGCTTGGCCGCAATTGTTTAGTGctgttttttttcttacaTTCATTTATTATTATGAATATATTACAAAAACGATAATAAATA
AGATTGCAGATTAAGTTAAATGCCTCATTTCTTCTTGTAGACACGAGGGTCTCAATAGACAACCGACGCGTGTGAGTGGTAATACCATGGCGAGAACATG
CCCTGCAGTTGATTCGTCATTGAGAGCGTAGCACAAATACCAGTCGCTGTCAATCCTTCCAGGATCACGCTGCTCACAACCGAGGTGAGCCCGACAAAAT
CCTCGTTCGACTGTACTGCGGTACAGTACAGCCGACGAGGCTTCTGCAGATTCACCTACATCATTCATCAACGGCAGTAGAAGACGCCTTCGAGTCGATG
GGTCtggcgaaggtgctggcccCGCCAGTTGATTACACCACGAGCGTTTACGCGTTATGTTGGAgcctcgtcgtcttggtaATCAACGAACGGCAAACTG
CATCTTCGTCCTCCGGCTTAGCTCAGGGCAACAAAAGTCGTGTTTAATCTCCACCTAGTCCTGTGTTGCGCATTGCAGTCATTTAacgctgtcgtcgacg
ttgttgtGGCCATGCTgcaacgcgcagcagcatcccaTCGCTGGCTACAGGATCAACAGAGCGCTATCGTCCCATCGGAGCTGGGCGTGTTTGAGTTTCT
CGTGCTGTGCTTTGAGCAGGTGGCTGTAGCTGGCGCCGTGGTTAATTGCTTCCAAGCTAAGGATTTCGACGGGGGAGATGCTCCGCTTTTGATGCCGGCG
GTGATGGACCACGTTCCGCAAGTGCTCATGGTCATCGTCGGGTTCAGCCTCCTGGTTGTGTGGGGTTCGCGACTCATTCAGTGGGGTCTTCGTAGTGCTC
TGCTAGATTGCACATGTCCTATGAAGTTCGCCACAAGACAGCGATACCTCCCCCCAGTCAtcgcgctgctcaagtcgttTTTCCTGCTGTATGTGACGCT
GCTCCTTAGCAGTTCGCCCGGGTTggagtggaagcagcagacgagTGGTCTTTCCAGCGCGCTCATTCTCGTCATGTGCGAActtgtcgatgctgttgcC
ATCGCACACACGTGGATGGTTAGTCGAGCACGCGACGAGATCATTTACGACTGGAGCAAAGAGGAAGCGGCGCACGGAAAAGTTACTGCCAAGAGGTTGA
TCCTCACGTTTTTCGATCGCTGGAAAGACTGCGGCATCGTGTCGTCCTTCCTGAATCAAAACGAGATGCTACTGCTCCTATCCGAGGTACCTTCCATGGC
CTGGGcaagctggacgtgctgTCAGAGAGGGTCAACCCCAGAGCATGTATCGTATCAGCTTCATCGATGCGTGACCGTAATGACGATTGTCATGGGCATG
AGCGTTGTCGAGGTGTCTATGACCTTGGAGAACGATATTGTTGGCGCCGTCATCTTTTTGGTTGCTGATGTCGTACTCACTGGGATGCGGTTGTCTGAAG
GCCGCCATCGACGCCATGATCAAAGACAAGTAGCAAGAGCTGAGCGACTCACCATCACCCCAACGAATGGTGACAATAACATCCCAACCAGTGATTTCTT
TCCGAGCCCGTCTGAACCAATCTCATACAGCCACCAGCAGGCTACTCACATTGATTCAGCAACTCCAGGCATGTGTCGAGTTAATGGTTCTCATCGTATG
CAACCAGAACGATCGGCTAACGTGCTCCAACAATGTCTGGAGCTTAAGCGACTTGGCGTCTGGAAGGAAACCGTACTACATGGTGTTCCACCGAAAGAAT
GGGTGTTCGCCTTGCTTGACTGCGCTTACTCGATTCTGGTGGTACTTAACTTCTTTGAGACGACAGACGCCGCTGGTGTACAAGTCATGCAGGGACTTTT
AGGCCAGGGTGAGAGCGAAGAGCACCTTTTGGAGGAAGCGGACAGCGTGGCGGTGTATCTCGCTATCGGATTTTCGAGTGTGCTGGGGATCTCGCTGCTT
GCTCGATGGTGTGTTCTGTACTCGTCAAAACGCTGGGCAGCTCCACAAACAAGCACTACCAGCCCCAATTTCTTTGCCGTTGGTGTCGTCATCATCATAA
TTGCGCTGTTACCCGTCTCGATCTACGTTGCCGCTGTTGTTTTCGTCCACGACAATTTGCTCACGCCAAAACGAGGTGTCAACGCGCTCGTGGCCGACCT
CATCTGCgctattgctgcagctcgagcggTGGACAGCTTGGGGCGAGCATTGCAGGGATTTGGTCGGTCTGCAGTAGGGCTCCCTGGAGCTGATTCCGTA
AAAGGTTCCACGTACGAGAAAGCTAGCATCGCGTTGCAAGTGTTCTGGGATCGGTTCAACGACTTCCTCGTCCCGCTGGGCATCGTCCACCTGGTCATTT
CGACGACGGAAGTAggcaagaacttcatcgtcgtctacTTCCTCCTCACAGTCTGCATCCTGCACGCCATGATCGCGTACGTTGATGCCATTGACATCAC
CAGCGCCACATATCTCGCTGAACGACTTGGCTACCTCGTCGCTGTCAGTTTCCTCGTGCGCAATTcggccaagtacgtggagCGCAAAGGGATGGATCTG
TTCACGCCCGTGTTACTTGTCGCCCTGGAAtttgcgctgctggtcgtggcaCTCAATTCGATCTGGACTGCGCATCGACGGTCTAGACGTGGAAAGCGAG
AGATGGAGAGGGGAAATGCAGGCATCGTCCCACCAAGCCGCGCAATGGCCCGCAGTATGCCAATGCTGGCCTCCATGAGCAGCGACTACTCCGCGCTCAG
CCCCAGCATCTACATGGGGGACACTGTTCACGATGAGCAAAAGGAGCAGCCGTATCCGTCGGATTCATGTCGAAGGCAATCTTCTTCATGATAAGTAAAT
GGACAAGGTTTGGAACGTATGAGTGACTGCGGTTCCTCCTTTGCTGGTGTCATGCATGCACCAAGCGCTACAACGTATAAATTGTCAAAATCGCGTCGCG
TCAGTATGTGACTTTGGGGGCTTGGAAATGCCAAGCCGCGGCTACCGTCGTCTCCGAGGATTCAGAAAGGAAATACTTGTGTTTACATGTGCTGTGTACG
ACGCCGGATATCAACTCCAGTTCACAGCACAATTGGCCTTTGGGAACGATCCTGCAAGTGGGCACCGCCGTGGCGATCATAACGTAATAGCTGTTATCGT
CACCTCCAAGCCGATGATGCCGCCATGAACCAATAAACGGAAGAACCAGTAAACTGGTGGGCAGGTAGCTCAGTTATCATAGCTAGAACCAGACTAGAAC
CAGCGTTCACGTACACATCCAACTGCGCAGTAGCCACCGCAAGCATTCTCGTAAAAGGTTATCAAGTTTATGaccgcaacagcagccttCCTGCCAACCG
GATTTGATGGTACTGTAGACAAATCGCCTGCACTTTGGTAGCTCGAAAATGCGAACAACGCGATCAAAAGCTGCATGTATAGCGCAGCCCGCGAGTAGTG
AACATTGGAACGATCCATCTGAGTGCAGCGAGTTCTGTGACACGGTCAACCGGGAAGACATGGGGTTGATTAAGCCTGCTACAGTGTTAGCTGTCTATGA
TGGCAAGTAGCAATTCGTTGTCCTGTACGCATCTGCTGATGACTCGGGAACAAGTCTCTGACAAAGTCGCCGCAGATCGCTGCCCCGCTCAAGATTACGG
CTTTGGGATTGCGTAAAGCGGGGCTAGCTGATTAGTGAAGCGACTTACCAGCGGCTCCTGTAGCGACTTACAActtgctctcctcctctcATTCTCAAAC
TTTCTCAACACACCACAAGCTCCAAGCCATCCACCCATTTCATTCAACTATGGTTcgcatcgtcatcgtcggaGGAGGCCCTGCAggcattgcagcagct
caagcgctggccaaggatCTCACTGCCAACGACGGCACGGAGGTGATCATTTTCGAGAAGAGTAAGTACTATTACCACGCTGTCGGTACGCCGCGTGCAG
TTGTGGATGCCGCCTAtacgaagaagctcttcgtGCCGTATGATAATGCCATCCCAGCGGAGGCCCGGTCCTTCGTCAAGATTCAACGCGCCATCGTGAC
TCGCATCATGCCGGGCAACGAGATCGAGTACACACCgattggcgacgacgacgaaatgGTGGCTGGTCCGGTCAAGACACTCGCCTTCGACTACTTAGTT
ATGGCAACAGGTAGCACGTACACAGTACCTTTCAAACAACCCAAAAACAACTTCAAGCGCTCTACAACCGAGTCGATGATGGCCGAAGTTCGTGAACAGA
TCGAAAACGCCCACAGTATCCTCATTGTCGGAGGTGGAGCGACCGGTGCTGGCGTGGCTGGCGAGATCAAGGCCAAGTTCCCCAACAAGGAGGTGACGAT
CATCGAAGGCAAAGACAGACTGCTCGGCACTGACAATGTGCGCGAGAAGTTCCGCGCCAGACTCCTGAAGTTCTTGAAGCGGTTGGATGTTAACGTCGTG
CTGGGCGAACGTCTGACGGAGCGACTGAATGGTaacagcttcgagcgacGCACACTACGCACCGACAAGGGTCGGGAGCTCGTGTCGGACATTCAATTGC
TGTGCGGTGGCTTCAGCCCCACCACGGAGCTGATCAAGAACCTTGATGAGGGTCTGGTTACTCCTCGGGGTTTGATCAAGCTGAACGGTAAACTGCAGCT
GAACGATGCTCGGTACTCAAACATTTACGCCCTCGGCGACGCGAACGACAACTCGGCACCCAAGCACATGCTCTTCGCCAGTCAGCAGGGCACGCACCTT
GGCAAAGAGCTCGCACTGGTGGCGCGCAAGACGCAGACCAACGTCACCAAGGACTTCCCCGAAGTAAAGGTCTCGCCGGCGATGGTGCCGCTTGGCCCCA
ATGGCGGTGTATCCCAGCTGCCTATCTTCGGTGGAGTGGTCTACGGCAACTTCATCACTAGAACGTTCAAGTCGAAGGAGTACTTCGCCAGCTTTGCCTG
GAAGGGCCTAAACGCTGAGGTCCCGAACTAAAAGCGCAGGACTCGTAGGTAAAACACGATACAATGGTAGACATGTACTACTACTTGGTTTAATGCGTTC
GACTACTCCATATTCATGCCGTGAGCGAcgcccttctcctcgtcctgctgtGCT