Description :
From Genome Similarity Track
Location :
contig_5:106099- 108711
Transcript NameFunction/comments
g1311.t1Sodium/glucose cotransporter

Sequence
2612 bases(100 bases per row)
TCAACATCGATGAGGGTCATATTCCAAGCAAAAACAGCACATGCGCTGCCACAAGTGCCGACTTTGTCGAAGCGACCGCCATCTCGCTGAGTTTGGTATG
AAGTCCTTGGGCAACGCGTGGATCGAGCTGCTCAAACTGTCGTCGATCACGTCTGATGTCTACGGCCCATTGCTGCAGCCACTGCAGCACCATCCACCCA
TCAGACGATTCGTCTTCTTCGTCTCCTTCTAAAAGCAGCAAGAACGCAGTGCATAATGCGTTGCGCACTGCACCTGACAACGTCGCTATGCAAGGAGTTT
TGATGATCGTCGTCGCACGCCGTAGCAACTCCAGATCGTCTTCGACAATGCACAGACGAAACGCTAATTCGTACTCACCGCACTGTGCCGCTTCCAAGGC
AGCCTCGGCACGAGTGAATTCGATCTCGCCAGAGTCATCGTCCTTCTCGTAATTTCTAGCTTCTGCCTCATTGATATGCTGGCGACCCTGCGGGTCATTG
TCTGCTTCGAGTAAGTTCATCGCTTGGGATGATCTCCGCTTGGGGAGGGAAATCTGAGGGATGCCTTGTTGCTGAGAACGCCGTGAATGTGTCTGGGCTC
TTTGCTTCGCTGCAAACTGCTTCAAACTTGTAACAGCTTGTACTGTTGTTGCAGTCAATGGGCGTGACTTTGTTTGAGAGACAACTGCTGTGGATCTAAG
CGGAGCGTTGTGAGCTGTGAATTCTTTGCGTCGCTCTTTGCGGAGAACTTCACTGCTCTGTTCGTCTTCTGATCGCGGGTGATCCGCTTGGTCGCCATTT
GCTGGTGCTGCAGCCTGGTCCATGAGCAGATCCATGAACCTCTCGTCATCTTGGTTAAGCTCAGCAGGTAGCAGGATACTTGTAGGTCTTGCTTCCGTCG
CTATCGTTGTATTCCCCCGCCGATTTGGTCGAGACCGGACGACTTTTTCTTGGCTGGTGGCACTGAAAATTGGCGCTAGATCGTCTCCGTCAGTTGAAAC
ATCATGCGAAGGTAGAGCCTCGTCTCCTGGTGTGGGATCACCGAAGCTTGGTGTGTCTTCCTCCTCTGTCGACTCAGAAGGCAAGGGTGACGAACGTGCC
CTTGCATCACTCACAATCGGGATATGAGTGTCACGATCATTGACCGCTGCAGGTGTTGCCCAACGTTTACCAATGTACGAATAGGCAGGAGGGTTGGGCG
GGACAAAGTCGTAGTCTGAACTAGCGTTGGAGCGGGACCACTGGCTGTTTGCGGGTACAACTTCTCCAAGCGTTCAAATGCCAAGGCTGCAGGAATGGCA
GCTTCGCGAACAAGAGAGACCGAATCGTGTCGGCCAGCCAGCACAAGAGCTCGCACTCGCTCCTAAGTAAGGTCAACAGCGAAACAGATAAGTAAGACTT
GTACTGTACATACAGTTCAAGGTGACTGCACGCACCAACTGAGCTTGAAAGTACCCTCTCGCTGTCCCAACGGAGGTGCACCAAGCAGAGTCCTGCAGCG
CAAATGTGTCAAGTAGCATTGTCAACAGCTCTTGTCCACGCTTCCGAAGTATCCAGTCGTCACGAGGGCCACACTGGAAGGTATCCTCGACTGCTTCGTA
GATTGAAGCGATGTAGGGAGCAAAGTCGTCACCGAGCTGCGTAAAAGAGGCTTGTTCGTTAGCATCTCGCGCTAACTGACACGCCGATTGCAACAGCAGA
AACAAAGGTGAAAAGGTTGCAAACATTGTGCTTCCGTCCATCTTCACAACGGTCTCAGCTAAAAGCGCTTTGAAGAACGGGCGGATGTGTGTGGCATGGG
CGAGCATTGTGGCGGGCCCGGGCACCGACACTCCATCAAAATCGACAGGGTGAAGCAGGCCACAAAGGCACCTGGTGGCTGCCTCCCCTATAGCGTTTGC
CTCCTTGGCAAAAACTGCAGCCACAGCTTCGAATGGCTGCTGAGTGTTACCATTTCCAGGAAGTGATACACTGGGGCATGGCAGAACATACAAGGCAATG
GCCGACATCAATATCACACATGCATCCGTCGTCTTGGTGTGTCTGTCACGAAGACGAAGGCAAGCATAGGATACAATCCGAGGCAAAAGTTTGGCTGTCT
GCGTTGGATGACATCTGCAGAGAGCTGCGAGTAGAAGAACAAGCATCCGCCGTGTTGACGAGCGAGTGGGTTTCTTCAGAAACAACGCATCGGTACAGCG
TCAGCACCCTCAAAGAGCAGTCAAACATCTATAGCAAGTCGTTCACCTTGTTTTTCTCGATCAGAGAATATACCTCCTTCACCAATGATGAATCCAATCC
TGGTAGAGATTCGCTGCAGCAGGCGAGTGGCAATCGTGATAGTTAGACAAGACTTGGTGTTTGTGCAGGTTTAAATTTCTCACATGAGCATAGCGAAAGC
TTGCTGCTGAGTATCTCGGTCCTCCAAGCGACCGATTTGGACGTTCAGGTTGCAAATTTCTTGTTCTTGTCGTTCCTTGGTCTTGCGGTCCTGCTTTCTC
TTCTTTATGGTGCCTTTGGGACTCAAACTCCCGTTGATGGCCCCAACGACTCCAAATTTCCCATTTTGCCCTGCAGCCCGTCGTTGAAATTGAGTCTCCA
TCATTCTTAGTG