Description :
From Genome Similarity Track
Location :
Scaffold_162:106085- 107196
Transcript NameFunction/comments
Phyci_246031Hypothetical protein

Sequence
1111 bases(100 bases per row)
ACCGATGCGTGCTTAAGCTCAAAGTATCCTAAGCACGTCAAGTCCCCTGCCTTGAAGGGTCGTAGGAGGCCGTGCACTAGGATGCCATTATTAACATGTA
AGCTACTTCTATCAAGAATACATAATCGACGGATTTCCTGATATGACGAAACCTGCGCGGGTACCCGTCATGTATTGAACTGTAGGATCTGCAAAGTTGC
TGCAACATTTTTATTGACACACGATATTTTTTTTAATAGTTAAAACTTTTGGTGTATCCCGCGACCTGCTCCAACTTCAAGTCCAAGGACACAATCTCCC
AGCAGGGGGGGGGGGTCGCCCCTATGTCCTCGTTTCGACTTCTGATTTGTCCTGTTTATTCAGGTCACACAGCTGTAGAACTGTACACTTAATTTAATCT
TATTTTTACTATAGCTCTTCCCATTTCAATTCCTCGGATGGAGCGCTACATAGTCGAATACTGCATGCCCTATAATTCATGTACATGTACAGTACAAGAC
GCTACAGTACATTACGCAGGAATTTACAATATTGATAGTCGATCTATTCTAACTTACGGTCGAATATTGAGTCTTCGTAGTGGGACCGTGGTACATGTAT
TGTACCTCGCTGGCAATGGTGCGATTAGGGTACACGGCAATCATTTATCGTTAGATGCACCAACGACTTCAGACATCATAACGAGTCGGTTTGCAGCGCT
GCCACCCATGGATCATGAATAGGGATGGCACTGAATTTGTGCTGTGTGTACTATGTAACTGGTCTGTACCTGTATAGAGATTCTCACCAATCTATCACTT
TATAACACATGTACAGTGTACATGTACATCTGTACCGTGTGATCGTAAAAAGCATGCGAAGTACATGTATGGCTTAGGATAGGCCTGTAGATTTGCTCTC
CGAACCATCACCTCTTGGCTTCTATCAATAACTGTACGTCAGTCGCAGTTCGTCCTCCCCACCATCACTTTGCTACTCGAGCCACCTGGGAACACACTCA
TGCGTCTTCACCGACTCGTGTTTGTATCTGCCGCCGTCCTACTTGGCCCTGTCAAGGGTGCAGTGGAAACCCAACTCTCTACACCTGGCAGTGAACTTCG
GATCCGGCCAC