Description :
From Genome Similarity Track
Location :
Scaffold_3:1060684- 1062039
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001332Similar to mps1: Probable serine/threonine-protein kinase mps1 (Dictyostelium discoideum)

Sequence
1355 bases(100 bases per row)
GCGTTGACGCCACCGCTACGTAGGAATGGATGGTTCAGCAGCCCTCCTGGACCGTCAATCGTCGGTCGAGCTCGATGGTCTCGTTGCAAGCACGACCGGA
TCACATTCTCGAGCTCTTTGTTCTTCAACGATGGGTACGGAATCGGGTAGCTCGGGTCGATAATGCAGCGGAATTTCTCAATGATACTGTTTACATCAGC
AAATGGTGGCTTCCCGTACACGATCTGGTACAAGATGCACCCAAGAGACCAAATATCACTGGCACGTCCAACCTGCGCGTTCGTGATTAGCATCAACATT
AGCGCAAAGAGTCACCTTTACATCCGCGCAAATGAATTTTATAACGAAGGCATAAGCGTACCTTCATTTTTCCTGATGGATTTCGTTGTCCGTTTGACGC
AGCATTGCCCTGAATAGCCTCTGGGGACATATAGTTGACGGTCCCGACCTGGCTGTCTCTCTCAATGTTTGTCGTGTCGTTCGAAATCGCCTTGGCGATG
CCAAAGTCAATGAGCTTGAGAGCGCCATTCACAAACAGAAAATTTGCTGGCTTTAAGTCGCCTACAAAATAGATAGTACGAGACCACAGGATTTAGCTCA
ATGTGCTGGCAATCATCAAGTATGACATGCAAGACCTCTTAACGCACCATGAATAATTCGTTCGCTGTGAATGGCATGCACAGCCTGAAGCATTTGAGTC
CAGATAACACGCAGAAAGTTTTCGTCAAGGCTGTCCTTGATATCACGAAGTCGCTCACTCAAATCGATTTCGCCATGCTCCATAACCTGACAGAAAAAAA
ACATGAAAAAGAAATGAGCATATACGACCAAACAAATTTGTTCTCAATAGAGTAGAACACTTACAACATTGATCTGGCGCTGCTGAAGATCCTGCTCGGC
GGCGATCAGCCGGATGATGTGTGGATTCCCTTGTAGCCGCTCCAAAAGTTGGATCTCGTTTGTGTATTGCTCGATACTTTTCGCATCTAGCCGCTTCAGT
TTGATTTTCTTCAGCGCGTAAATTTTCAGGTCGGGTCCAAGCATGCGATACACTTTGCTACTACCTCCGCTTCCGATTTGTTCGAGTTTAATGTACGTCA
ATCCTTTTACCTAAACAGAAGCAAAACGAAGCGCATTGTCAGGAACAACAATACACAAAAATGGGGAAGCAATTCTGAAAGTACTTACGACAAATTTGCT
GGACAATGACGTGAATGGATCTCTGGGGACATTGTCACCGAAGGTAGTAAGCGGTGATGATGCAGATGAAACAGAGCTGACTGAGAGAGGGCTGCTGTCG
ATTTGATGACTCACGATGGAGATTATTCCTTCTGCTCGTTGCTGGCGCTTTGGTG