Description :
From Genome Similarity Track
Location :
Scaffold_383:10605- 14485
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_383-fgenesh-gene-0.0HECT E3 ubiquitin ligase
Pytve_DAOMBR484maker-pve_contig_383-snap-gene-0.25Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_383-snap-gene-0.26Eukaryotic translation initiation factor 4E

Sequence
3880 bases(100 bases per row)
ACTAGAATCGATATATGTTCGGCAGATTTCCTGGTGTCGAAGACGCTGAACCGGCACAAGAGCTCCAAGACGATCCTGCAGAACGCAGTGGACGATGCTG
CTGTTGCTGGGGTTGGCGATGCGCCAACTGGAACCAGCGAGGAGGAGGACCTGCGCGCACGGCAGCGCGCGTTTGTCAAGCGGCGACTGAACGCGCTCGA
GGCGCGGCAGAGCCTGTCGCAGCGCCAGCGTGGGGCGATTCGCCGCCGCGTGTGGGAGCGCAAGCAGCTGGACGACGGCAAGTTCCACTGGATCCGGCAG
AACAGCAAGGACGTCGTCAGCGCGCAGCTGCCGAGCGTCTCGAGTACGATGCTGTCCACGTCCGACTCGCTGCCGGACACGCATGCGCCGAAGGGCGTGG
CGCTGTCTGGACCTGATGGCCAGAGCGTCGTGGACTACCACAACCTGCGCTCGCAGGGCTTCGTGTCGCACTACGATGAGCTCGGTCGCCTCGCGTGGAA
GCGGGCCGACGAAGGTACCAACCAGACAAGGCTTGGCATTGTGGAGGTGACAGAGGTGCTCATGTTGATGTTGATGTTGATGTTCTTGTGTGTATGGGAC
AGTATTGATCGACCTGAACTCGTCCGAGTTCAAGGACGCACTGGTGGCGGACGAGAAGATCGACTTCGAGGTATGGCTTTGGAGCCGTCAAATCTGGTTC
AAACTCGCGGCACCGACGGAGACATTGTGTATTGGCAGGGTGTGATGGCGTTAGGCTTCCAGCGCAAGAAGCAGTGGTTCCTCATCCACTTGTCGCGGAT
CGCCACTCCCGTCACAGAGGCAGTCGCGAAACTGAGTACGTGCATCGGTGTCACTCGACGCCAATCAGTCCGGTGCAGGCTAACATTTTGCCCAATGTTC
TTCTGCCAGCCGTCTCCCGGGATCACATTATGGACGAGACCATGCAACTCGCGACAGCGCCTCCGGATGCGATGCGCACCTACTTGAAGATCTCGTTCGA
CGGCGAGCCGGGCATTGACGCCGGCGGACTCCTGCGCGAGTGGTTCGGGATTGTGTGCAAGGACTTGTTCAGCGAGCAGCGGGGACTGTTTATCCCGACC
AAGGGAGAGGACATGAGCTATTGGATCAACCCACTAGCCGGAGACACGAACAAGGAGCACTTGCAGTACTTCCGGCTCGCTGGCATCTTGGTGGGCAAGG
CTCTGTTCGAGGGACTTGTGATGGATGTCCACTTGGCGCTGCCGCTGCTCAAGCACGTGCTCGGCATCCCCATCTCCTTCTCCGACTTGGAGTTTCTCGA
CGCCGACTTGCACCGCAACTGCCAGTGGCTGAAGACGAACGACCACGCTGAGAGTCTGTGCCTGACGTTCAGCGTCATGCTGGAGAACGGCACGGAGATC
GACCTGAAGGAGAACGGCCGCAACATCGACGTGACGGACGACAACAAGGAGGAGTACCTCCAGCTCGTGCTCGAGCACCGCATGCTCGACAGCATCGCTG
AGCAGCTGCAGGAGTTTCTCACGGGAATCTACGACGTGGTGCCCAAGTCGCTGCTGTCCGTGTTCGACTACCAGGAGCTCGAGCTCATGCTGTGCGGCAT
TCCGACCATCGACACGGCTGATTGGAAAGCGAATGCGCACGTGCGGTACATCAAAGAGGACGAGAACAAGCGGCCGAAGCTGACCGAGGATCAGCAGAAC
TCGGTGGTCGAGTGGTTCTGGCTGGTCGTCGAGGGTATGACGCCAGAGGAACGCGCGCGGTTGTTGCAGTTCGTCACAGGTACCAGCCGCGTCCCCGTCG
AGGGCTTCAAGGGTCTGATGAGTTCGAGCGGCATCATCCACCAGTTCACGATCCAGCTCGTGCGCCGTGGCAACGAAGGCGGGGACTTGTTCCCCAAGGC
GCACACGTGCTTTAACCGCCTCGATTTGCCCGTGTACCGCGACATGGACGAGCTGGACCGATATTTAACCATGGTGTCGCAGATGGAGATCTTTGGCTTC
GGCCTCGAGTGATCCGGACCCCTCTATGCGCGCGTAGCCCGTGATTTGTATGACATGAGAACGCGACCGTACATTTGCTGGGGATCTGTTGGTGTGTCTA
GGAAGCGCATTCATTCGCGTGCGGCCTTGTCCGCTTTGGCGGCTCTGTACGCCCTGATGTCCTGCTTGAGCTGGTCCTCCTGCCGCTGCTTGACGCGCTC
GTTGATACCGCTGGGCGAAGCGTTCGCAGCTGGCGCCGGTGCAGTGTTCGCGCTTATTGCCGCCTTCAACGCCTCTTTTCGCTTGTCCCACATCGATGTG
GAGGCTGGCACTGCTTCGGAATCTGTAGTGGCGGCCTTGTGGCTGTCACCACTGGTGGGCTTTGCATCCTGGTTCTTCGCTAGCGCCTCGTCCTCTAAGT
GGCGGATCCGGTTGCGCAGATCCTCGATCATGCCGACGAGCACCTCGTCCTTCCGCTCGCGCGCGATCTCGACCTGCAGCTCATCCTCCACCTGCTCGAG
CCGGACGCGCTCGTTCTCGCGGTTCATCTCCTGCCGCACCGAATACAGGTACAGACCCGCCACCGTGCCCGGCAGGAACGCGAACGCGCCGTACATGAGC
TTGCGGCCAGGAGACAGCAACTTCCTTCAAGTGACGGCGCACATACACGAGGCAGTTAGGCGGTGCTGAAGCCATTAGCAGCAGCTCAACAGACAGCCAA
GTGACTGTTACTGTGGACAGTAATAATACGCTGCAGGCACTTACTCGAGCGCACCTGGCGGCGCATCGGAGAACAACTGCTTCCACATGTTGCCGACGCT
GCCAACAAGTCAACAGCGATGAAAACCAAGAGCGAGTAAAGTACGGCTGACGATCATCGATGAGCAAACATGCGAACTTAACACGCTGACAAGGACAAGT
TCTATTGAGGCGTGCGGGGGCCAGAGTTCTATGTGCAGATCGACCTCCTTTGCTCCATGACCAACACGACAGGACAGCGCAGCCCACTCACGAGAGTCAC
GCTGGCCTACACCCTGCCATTCGCTCGTCAACAGCGATACCTGCTCGCAAGGATCAGCCTAGTGCTTCTTGTAGACGAACTCGTTGGGAGCCCAGGCCGG
ACGAGAGCTGTCCGCGTTGATGCTCTCGAGGATGCGGTTGCGGATGTCATCCGCCTTCGTGCGGTCCGTGCCTCGCAGCCAGATCTCGTAGCGGTAGTTG
TTCCCCGGGTCCTTCTTGTCGCGCTTGTTCTGTCCTCGCACCATACACACAGCTCAGCTCTGCGTCCCAGTACCACACAGCGCATCCTCGACTCTACCTT
GTGGATCACACGGACGCCAGTGACCTCGTTGCCAGGGTCGATCACCTCGCCGATGGCGCCTAGCACTAGCTTGTCCCAGAACTCGTCCAGGTCCTCGCCA
TTCAGCTCTGTCCACCACACATACACATACACATACAAACTGAGCCACCTTGCTGAATCGGGTGACACAACCAGGCCGCGGACGCTACCTTTGCGGACCG
ACCACTCGCCGCCGCGCTTGTTCTCCGGGTCCTCCCACTCGGGAGCGATGCCGTCCTTGAAGACCGCGAAGGACTCGACTGTCCGGTCCGCGAACTTCTT
GCGGACGAACCCGTCAAAGAGCACCTCGCTGCACAAAACCACGCCAGTCCCACCACTCAGCCTACTGCAGTCGCACACTCTATGCCACAGAGCACGCACC
TGGGCTTGGGGATGTTGTTCCAGTAGCCCCAGAACTCCTCGACCGTGTTGAACGTACACAGCTTGAACAGCTTGTCGGCGTACGCCATGGACCGCGAGTT
CTGCTCGCGCTGCTCCCAGATGGACCACGCAGAGTTCAGCGTGTGCACCTGCGCCTTGTCGTCCTCCGGCGTCGCCATCT