Description :
From Genome Similarity Track
Location :
Scaffold_6:1060383- 1063058
Sequence
2675 bases(100 bases per row)
GTACCGCTTAAGACGTCCAACATAGAACGTCGGGTGCGTCGCCATTGACTTTGGCAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTTCAAAT
AATCCGATGAAGCGGTGCTTCATCTTGTTGCTGCCGACAGAGCTGACAGTGTCAAGAGGTAGGATCCTCGTGTCTAGTAACACTAAGTCCCCCACTTTAA
ATACACTTAAGTTTCCTCTTCCATGTTGTCGGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAACGCTCAACTTG
GTATTCATAAAGGATTCCACTTGTTTTCCGCAGCGAAACTGGTATCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATA
GAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGACGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGACCCCCGTGGA
CGCTTGCACCGCGTTGCTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACAGTGTCCTCGAGCACTCGCTTG
ACACGCTCTGTCTGGCCGTCTGTCTGTGGATGGTCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGA
ACCGCGGGTCTCGGTCCGAGACAATCGCCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTAACAGTGAC
GGGAACCGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCA
AGACTCATCGACTTCCAACAGTCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCGCATGTCT
TAACGTACCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCTAAGTGGCCGCTGGAGGGTGC
GTCGTGCGCCTCCGCGAGGATATCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGTGCTCCACCCGGTAATAGAGGAGTCCA
TCTTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAATGCCAGTCGGACTTCGCGCTCGTTCCTGTCATAAGGAACTTGACGATAGGCGCGA
CAGCCTCATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAATCAGGACGCCGAGAGAGGGC
GTCCGCAAGCACGTTGAGCTTGCCCGGCTTCTATTCAACGCGGAAGTTGTATACCGCGAAGAAGGGCAGCCACCTCGCCATCCTTTGGGAGAAGTGAGGC
GGGTTAGTCGCCTTCACCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCCTAGAGCCCAGAAGGTGAACACAAAACTTTACAAGGGCATATTTTATTG
ACAGGAGCTCCTTGTCGTGGACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCTGGACTGGAACGGGATGACTCGTTCGTGTCCAGCCGTGTCGGCCTG
CAGCAATGCACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTG
GCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTGGACAAGGGCTTAGCGAACCCGCGTACCC
TGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTTTGGGATCAGGGCGTCGGCCATGCAGCTATGGCCTTGACCTTGTCT
GGGTCAGCCCGGACGCCAACGTTGCTTACGAAGCAACCGAGAGCTTTAATCTCTGGTGATGCGAAAACACACTTGTCGATGTTGGCGTAGAGCTTGTTCG
CTCGCATTACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTA
CGTCTGTACGAAGGTACGCAAAGAGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCAGCATGACGAGCCACTCC
CAAAGCATGCCGCTTGGAGTGCTTACCGCGATGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGATAGTATCCGTCTACCAAATCCAGCGCACTGTACA
GTACGCTCCCGGCCATGTTGTTCAGCAACACATCCTTTCGTGGGATTGGTGTTTGGACCGGCTCCGTCGCGGTATTCAGCTTGTTATAAGCGTGCACTAG
ACGCCACTTTCCGTTCGGCTTCCGAACGCAGAAAGTTGGAGTCGAGTGCGGGGACTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCACAGCGAAGAAG
GCATCGATGACCTCGCAGTGTTCTAGCGGAAGAGGCCATTGTCTCGTGACACCGTACTTTGTGCCAGGCACAAAA