Description :
From Genome Similarity Track
Location :
contig_2:1060151- 1062769
Transcript NameFunction/comments
g751.t1XP_008891945.1 hypothetical protein PPTG_02571 [Phytophthora parasitica INRA-310
g752.t1ETI49853.1 hypothetical protein F443_06462 [Phytophthora parasitica P1569

Sequence
2618 bases(100 bases per row)
TGCAGCTGCTCTAACGACGCTCAAATCTTGCGTCCAACGTACTCCAGACACGGAGCTCGTCAACTTTGCTTGTTGAAGGAACTTAGGTTGAGCTGCTGAG
TTACACGAGCAAAGGATAGATCTGGGCGTCGTACACGGGGTCGTGCTTGCACGGGAGATTCGTCGCCAACGACGTGTAGTCGAACAGCCAGCAGTCGTGC
GGAACGTCCGACACCTCGTGGATATAGAGACCACCGGCAGTGTCGAGAGTCTTGAGGCCGTACAGGTCCTTGGTGTACTCAGCCGTGTCCTTCATGTCGA
CGATAGTGAAGTCGCTGAACTTTGTTTCAACTTCGTCCAGAGAAGCCACCGTCGAGTACTTGCTTAGAACGCAGCTCTGCCACGGGGCCTGGATGTCGTC
CTGCGGCGACGCGAAGAAGTGCGCAGCCTTGAGCTTGACGAAATTGGTCTTACGGCGAGCCTGGTTGGTAGTGCACGTGGCGTCGGTGCCGCACTCTTGG
AGGTTGTTGACCTGAGGAAGGAACGGGTCAATGCTGAGCCAGTTGGTGAGCGCGGCGTCCGCCAGAGGAGGCGTGATGATGTTAGCGATGGAGCTCTTGG
CCTGCAGCTCCTTGTTGGTGGTCACCAACTCGACAAAGTCACGTTGAAACTTGCCATTCCACGTCGTGGAGTCTGCTTCGTACTTGGTAAAGTTGAAGTC
GGCCGCATCGATAGCGTACGGGCCCAGAGCCTGCAGCAGCACCTGCAGTGGTACGGCGTCCGAAGCCTGAGGACCGAAGAAGTTGCCATTGCCATCGCCA
GCCATGCTGATGAGCGAGTGAACGCTGTGGTCGTCCATCTCTTCAACCACACCACGAGAGACTGAGCCTCCCTGCGAGTGAGCCAGGAAGTGGTACCCGT
TGGCGTAGGTGGCAGGGCTCTGGGCAATGATGCCGCGGATCTGCTTGATGGCCATCTGCACCTGCTCCGACAGGGCCGTACGCACCGAGCACTCGTTCTG
GCAGAAATCGAGAGCGACGTAGGTGCGACCTTCAGCGGTGAGGTTGGCTTCGATCTGAGCGCCGTTGGTCTTGTTGCCCGTGGCTCCGTGGAAGAAGAAG
ACGGGGAGCTTGGCAGTCTCTGCAGCGTCGTTGGCAGCGACGATGGCAGCCGTAGCAGCGAGAAGAAGAGCGCGAACGGAGAACATGGTTCGAGACGAGC
TTGAGACGGGCGGGTAAGAGCGAGCACCGCAAACGCGAAATGAGCAGATCGAGCGCTCTTGCTCCTCTGACGTCCGACGAGCACAAACCGAATCCGCACA
GAGCGCTGCCCAGCGTCAGCGATTATGGCAGCGGATGCAATTCAACATTTTCCAGCTTGTTGTTGTTGTTGTTGTTGTCGCAGGCTTCGCTAAAGGCTCG
CGAGTCGCGACACCTACCGATCCCATACGTTGTCTTCCAGCTGGATCACTGTGTGTGTGTACACTGTGAAGGCAATCGGTACACACGCAGGGTTTGAAGA
GAACTCGAGGCACTTGATTTGAGTCGGCCAATGGAGTTTTCAGGAAACTTTTTTGCGTTTGGAACTCTTTGTTGCAAAAGGGGAACACTCGATTTAACCA
TGCTCTCAACTCGCCAAGTCATAGGTTCAACGCCGTCAGTTTGGACCTTCCGACGCATTTGTTGTGCATCAAGTTGCACCGACTGATGAAGTAGCCAGAC
TGGGACTGCCGCTTGGATCGCAGCGCCATCACTTCAAAGCGACACTCGTCCCCCCCGTCACATTTGTACGTGACCATCGAACCCCCGTGCAGTGTGGCCA
ACAGCTTGATCGTCATGCCGTTTGCTGCCGCGTATTTGCGCAGAACCTTCGTGCACGACTTTTGGTCCGGAAAGCACATGCCCTTGGTGATGCTGACGTC
GGTCGAGCTTGATGCAGGAGGCTCCATTGGCTCGAGTGAAAATCCGACTTTTTCCCTTTTGGAAACAAAGAGTGCCAAATGTGAAAATGTGTTTGATAGC
TCCCCATTCTGTGAAAGAATCAAACGGTCCGGCTTGATGGCTGCAACTACTTTCACAACTTGTTCAACGTGCCCATCGATGTGCACGATCTTCCGTCGGC
GATCGTCGAGGTTGATGACGGTTAATTTGCGATGGCGATCTATCGGTTGAAGCTGCAGCAAAGCGGACCATTATACATACAGGTGTATCAACACTTTCTA
CTGTACCAGTTTTCAAAGTGGTGTTTCTTGTTCTTGATTTACCTACGATTTGTTTGTAGTAGGTAGATTGACTGCAGCTTCATACCAGCACCGGATAGAT
CTGGGCGTCGTACACGGGGTCGTGCTTGCACGGGAGATTGGTCGCCAACGACGTGTAGTCGAACAGCCAGCAGTTGTGGGGGACGTCCGGCACCTCGTGG
ATGAACAGCCCTCCAGCAGTGTCCAGCGTCTTGAGTCCGTACAGGTCGTTCGCGTACTCAGCCGTCTGCTTCATGTCGACGATAGTGAAGTCGCTGAACT
TTGTTTCAACTTCGTCCAGTGACGCCACTGTCGAGTACTTGCCCAGTGCGCAGCTCTGCCACGGAGACTGCAGATCATCCTGGGGCGAAATGAAAAAGTG
CGCGGCCTTGAGCTTGAC