Description :
From Genome Similarity Track
Location :
Scaffold_264:10601- 17184
Transcript NameFunction/comments
Phyag_g4086hypothetical protein PHYSODRAFT_389185
Phyag_g4087conserved hypothetical protein
Phyag_g4088hypothetical protein

Sequence
6583 bases(100 bases per row)
TCAAAAATACTTCTCATCGTACCCTGCCGTCGCTGGAGTTTTTTCTCGCGGAGCTTCTTTTTCCGTGCAAGCTCCTATCATCATGCCAGCCATTTTGATA
AGTACATGTATCAGTATCCAATTTGCTCAACAACTCACTACCGTAGGTAGGGCATGATCTCACCTTCTTTGTTTGCCACATTGTAAAGTACTTCTTTATG
GtggcatcgtcatcttctttcTTCTGCGATAGCCATGGCTTCGTCCTAGATAGACAACACATTAAAATAAAGACACGTTAGTGGAGCAGCACTCCCCCCC
CCCATACACGATAGCCGAGTAATTCTTACTCGTCCATGATCTTGCgcaacttcctcttcgaTTCGTTTGTTTGGTCAATGCAGATGCGTAGTTGGTGCTG
TAGTGAACGGATCTCCTGTGATACTTCATCATCCCGTGGGCTGGATAAGCTGAACTGTGTGAGAGCTTTATCATCGCCTTCAACCAGCCCAATATCTCGA
AGGACGCCTGTGATGCCATTCGGGTTCCACGATCGCATATCCATCGAGCGTAGCAAAGGGATCGTTGAGGATTCTTGGCTGTCAGGAGCGAGTTTATCTT
CGTCATCGGGCTGTGATCCATTTAGCTgaggccgaggagaagaagccgctgcatTATCCGCTTTCTTCGAAGTTGGGGTTTCTATTGGACATAGCGACGC
TATGAGTCTCTACACCATCAATATTAGTAACATTAGCAAGATAGAAATTCATCCAGGTGCAACACAGCAAAGCGAGCGTAATGACCAGACGTACCTCTTT
GAAAAAATCGTCCAGATCACTGGGAGTAGACTTTTTCAGGCTGAAATTATCCTGCATTCGTTCAAAATCGAGGCCTGCCATAACTTTGTTGTTTTCTTCC
TTTGGCTCCATGTCTTCAAAAAATGCGTGTGGATCTACATCAAATCAAACGACATATATAAGCGACGTACGAGTCCGTCGTCCACGTCTTGCGATTCTTT
TACCTTCAAGTAGCAACGCCTGCTCCATATCTTCCGGTGTGATCGTCTTAAAGAACGAGTACGCATACAAATATTTCCACAGTCCAGTCGTCGTGCACGG
GGTATCTACaaaaagcaacaacaacatcagccatctccacttcaaccacactgcaccaccacaataaaaaaaactCACCAGAATTcagatcttcttccac
catcGCCGGAGTCGGAGGTTCCGATTCACTCTTGAAAATACCACTAAATTTCCCTGCAACTgcggcagctccaacacCGCAATGTCTTCGTCCGtccgca
gcaactccagcagtCGGCGCTGCAACTCCCGGAGTGTCCTCCACGTACATAATCAAATGCGGCGGGAACATTTCGGCACTCTTGCCGTCCAAATAGTCCG
ATATAGCCAGCAACTGCGTGTCCAACTGGGCCAACTGCCTGTCCACATTGGCGCGTCCTCGCTGCACCAATGACCAAATACCAATTCCGGGTCAATTCAA
ACATCATTAATCCAATCCAAAACAGTACCGCAGTTGCGTCCACAGTAGATCAATGCAGTATGCATTATAATACAGATATCGACGCACCTTGAGCTCCTGG
ACGACCTTGATGAGCGAGTTCTTGCCGTTGGACACGAGCccgtcgtcggtgctgcaggccTGTTTTGTGGCTGGGAactgctcgtgctgcagccacggAA
CGTGGAGCGGCGCAATTTCCCGCCGTGTGGCGGTAGGTCGACTCATCTTCGCACTCGAACGCGCGCGGGTTGCAGTGTGTCAGCGCTGCGATGCGGTGCC
GAGAGCTGCTGACGACCTGTGCGCATGCAGGCGAATACACTATGGTTTCCGACGACCGATATATACTACCGTGTAGCTCCAAATAAGTCCGATTTAAGTG
TGCCACAACAGTATCTACTGATTTGCTGAAATTTGTTGTTAAATcatctgattggctgaaaagttTTTGGCGCGAAATTGGTGGAGAGTACCGTGGAAGA
GGAGTGCAGTAAAAAAGGGAGAACGGTAGCTCTTCTCTTtttgaccagcagcaacttcgacaatgGCGCGTGGGAAGGCGGACCGGGCGCTGACCgtggg
caagaagctcgagatcATCGAGGAGGCGGATCGCACGGGGCTCATCTCCGCCACCGCGCAGAAGTACGGCGTCAAGACGGGCCAGATTcgcgactggaag
aagaacgtggaCCGACTGCGGGCCACGGATCCGTCGAGACTCGTgtgcgccagcaccatccaGCGCGGCCACTTGGTGTTCAACGAGACGTACGCGCAGT
ACTGGGTGGGCTACAACaagttctgcagcaacaacaccaactACGACGACCTCAAGAACGCACTGCGCGTCACGCATAAAGACGTGCTGCGTGAAGGTGT
CAGTAAGTTGATATTGGCTCAAGTGTTGGTCTATTAGCTGTCGTTCGTGAGGGTATTAACAATGAACTATTGTGTATGGGATGCAGACGGATTTAATTAC
CCCGCGACGGTGGACCCGGCAGCGACCCATGCATTGGAGTGTCCTGAGAACAGTACGACGGTCGTATTAGTGGCGAATGGGATTTTTCGACATGGCGCTG
acggttgttgttgttactATTGGTAGATGGTTTCTATACGACCGCGGAGATGAAGAGTTTGTACTTGAAGgacatgacgtcgctgcgGGATCAGCTGCGT
GAATTTTTCGGTCAGAAGCCATTCCCGACCAAGTATCTGTACTTCGTGACCAAGCTAGATTTCGTCAAACCCGATCCGAACGACCACTCGGATGAAGATG
AGAATGGCGGCAAGACGACGGACAAACAATCGGAGAAGCCTGTCGGCGTGGAGGACGTTATCTCGTTCTATGTGGCGATCTGTGGCAACGGGTCAGTCAT
GGTGCCCATGTCGATTCTCCCTCCGGTAGAGGAATGGCACTGGGAACGCAAGAAAAAAGTCAAACTGCGTCACGCTCACAGCATGCACCGCACCAAGATG
AACGACCcgaacgaggcgctgcagtttttCTCGGTGGTACGTGGAGATGTAACAATTGGTGACAAGTTGAgaatgttgaagttggcttTTTTTGTTTTGG
TTATCAGACGTGGAAAAAGTTTTATGAAGAGGAGGCCAAGTACAGTGACAAGTTTGCGTTTATGCTGGACTACTCGGTCGAGGAGTTCCGTTCACCCGAG
TTTCTGAACGGtctgaagcagctggagggCTACAACAAGTACTGGACGACCTTGTACACTGTGCGCAACCCGCTGCGTCTCTCTCGTTTCGAGGACACGC
TCTCGACGTTCGTGATTGAGGAGTGGCGGAGTATCCTTCAGATGAAAAAGTCTAGCCAGCCCAACGACTACCGCAAGTGTGTCGCCTTTTGGTTCTATTC
CGCCTGGGAATTCTTCGCAGGCGACAACGCACGCGCAGCGTTCCGAAGCTGCAACATGTATCTCGAGGATAAGGCTGCGTGGGGCGTGGAGGATAGTGAC
TTGGTTTGAGCGAAAGCAAAGGGACTGCCATCTTCTTATGTtgtgttcttctgctgcacttgtgcATATAGGAACAGCGTgtgctgtacatgtactgcgT
TCGTCGGAGGCAATGTACTCGAAGTACTCCACAGCTTTTTGTTGCTCCGTTagtcttcatcctcttcaccctcttcatcctctgcttcgtcttcatcggc
aGCGCTATCGTTGTCCTCTGCGATGGGATCGGAgtcatcttcttgctttccatcgacaacttcatctGAGTTTGCCTTGGTGTCCTTGTTGTCATCATCG
CTTAAAGAAGGGAAATATTCCTTCGCAACCGTTGCAAGTCGCTGCGCAGCCCACTGTGATTCGACATCTCTGCTTTTCGTCTTGTTAGAAGCAATAAAGT
CAAGGTTCTCGTAGGACAGTTTACCAAATTGCACCGAGCTCGAGAGGTCGAGCGTCTTGAGTTCGTCTGAAGCGCTAGCGTTagcgtcgacttcaactaT
AAGCTTTTGACCCAGATAAAGCTTTGTTGTGTCAGCAATAGAGTTCCATTGAAGAAGTTTCTGAATACTCGTGCGGTACGTGAGAGACAACGAACGCAGT
GTCTCGCCTGCCCCCAGGATATGGTACTTTTTTCTGTCTGCCCCAATGCCGTCTCGAGTTTGCCAAAACCACAACTGCAATTTACCATCGGCCGACATGC
TCATCAATCGAGTACGATCAAACTGCAGATCCAACACACTGTCTTGGTGGCCGTACAGCGTCTGAAGAAGATTTCCAGTAGCAAAATCAATCACACAAAT
TTGTCCACTGCTCGTGCCGCTGACGATGCGTGTAGCGTCGAACTGAAGACATGTCACAGCTACATCTCGATGTACATCGCAGATCCGAAGCAACTTATTA
TCTGCGTCCAGGTTCCAAATCACGACCCGGCCTGAACTATCTCCACTTACAATTTCGTTGGCAACGCGCCTGATGCAGGTGACTGGGAAGAGATGCCCGT
TGAAAAATTCATCTCCGCGGCGTTCTGCTTCGAGGCACCATACAAGTTTTACGTTACGACGTATGGTGTGCTTTGAGGCTTCACCAAGTCCCCATACTTT
GATTTTGTTatcagcagctcctgttgtGAGAGTCAAGTTAGTGCTTTGAATGGTTAAAGCTGTCACGGTGCGGTCGTGAGTAGAGATAATGTGGGCAACT
GTTGCCAATGACTCGGCATCAAACACGAAAACATCGCAATCTGAACACCCACAGGCAACCCATTGCGTATCAGCTACAACGCtaacaacagcagcgtcaa
agTCGGTGAGCATACGTGTCAGCGAACACGAAAATCCGCCGATCATCTCGCTCTTTACTTCCCAAACACCCagtgcagcatcagcagatCCGGTGTAAAT
ACGGTGGCCAATGTAGTACATGGAGAGTATTTGATCTTGGTGACCTGTAGGATCTCCAAGATGATTCTTGAGTGGATCACCGACAGCCTGGGCTAAGCAT
GCGCCAGACAGAAAATCAAACAAGTAGCCATTGATGCCTGCAGTTCCAAAGCAAGTTGTAATTCCGTGACTTGCGGTTCCCACCACATTTCTCAAAGCCT
CATTTGTTGCATTGAAGCGAAAGCACCGCATTTTCTCTTTGGATAAAACTTTGCGCATAAGCGCACCTGTCTCCACCGCCAACTCCTCTTCTAGACCTTT
GATCTCATCCTCGGCATTACTGATGCGAATTTTGCCATTTGTGATTTCTTTGACAATCTTCTCCTCACCAGCCTTAACACTTCCCAGAAGTTTTgccagc
ttcaccttgaaATCCTCGATATCATATCGCTCGTTGGATCCACTAATAATTGCTGAATCAACTTGAGACGCCTCACTAGCCAGTGCTCGCTTCAGATCAT
CTTCACCTTTCGCCAGCAATTCTTTCTTCTCATACAGCAACTTCTCTAAACTCACCACGAGCTTGGCCTCTTCGCGAATATCAAACTTGCGCTGAATTCG
TTCCCTTCGTAACCTCGGGACAATGGGACTCACCCGCTCAAGTATAATTCGGCAAGAGGATTCAGCACCGGCCCCCACCAAccgttgctggagcttgttT
ATCTTCTGCCCTGCTGATGAAAGCTTTTTCGTCAGAACGAATTCGATGTCGTCTGCGTGATTTTTGTTGATTTCCACCATCTCTCGGTCTTCGAGTCTCT
CATACACGTGCTGCAAACCGCGATAGCATGACAGTTCCCCTTGCACATCCCTGACAGCTTCGAAGAGTAGTAAAGCACGCTCATAGCTTTCAATACTCAT
TCGAAGAGACCGAAGCTCATGCTGGGTATCTGCAATACGGAGCAGCGCTGAACCTTCTTCGTAGCGCAGACCATATCGGTTTGCCGAAATTGATGCGCGG
TTGAATATGGTTAATGCTTGTTCATAGTTCCTAAGCCGGAATGTAGCTTCACCGATCTTCAGCTGCACCTTTATTTGTTGCGCGTCGTCCATTTGCTGCA
CCCACAGATCATTGTTATAAACAAAATTGAAAAGCTGAAGCGCTCCTTCATAGTCTTGTAAATCCATCTTCGCGTCTCCTTCCAATAGAAATGGAAAGTA
tttcttgttttgttttcGACGATCAAGACTGCCTTCAGACGCTGGATTCTCAAGTTTTGAGGGTAGCTGCTGTCCCGTCGTCCAGCGAATGTCTTTTAGA
GAACTATCTGTCGTTCGAAGTTGGTGTAGCAGTTGCTGAGCCTCTATCATAAGATCGTCGCGACCTAATGCAGCATTCAGCAGACCAATGCTGCCAATAC
CATAGATCCCATCAACTCCGGCATTTGCACGCGTTAGGAATTTTGCAACCTCCTTCCATCGCTGAATTGCGCTCTTAATCCGATGGTTAACGAGACTGTT
GATCGCAGTTCTCATTTTCCTTCGTATTTCGTGCGCTTCCTGTCTGTTTGCAACAAAAGCAGCGAATGCTCTATAAAGCAGACCACCACGCAGTTTCGCC
AACATCGCTGTAGCTCCAGTTGCATCCACTGCATATTCCGGGTTGGTTTCAAATACTTCTAGCGCTTCTTGCCTTTCCTTTAA