Description :
From Genome Similarity Track
Location :
Scaffold_1856:1060- 2598
Sequence
1538 bases(100 bases per row)
CATCCTTCTCCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCAACCAATGCACCCA
CTCTAATGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCA
GCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACTGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACG
CCCATTCATTCGCAAAGAGCATGACGTGAACTGCTTTCGACCGATCGAAGTGCCTGAGAATGGGTGAATGTGAAACACTCGTCTTCAATTTTTCGAAGGA
ACGACGTGCCACAGAAAGGCCACCTTCAACGGCAAAGTCCTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTG
TAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTTGGCGATGACCGCAAGCTTCTTGGGGTCAGCCCTGATAC
CTTCTGGCGAAATTTTATGCGACATAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAG
CAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATTATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGAT
TCGTCTGGTTCCCCGTTCGTAAACATATCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACT
TTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGCTCTTCAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTTTCG
GTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCGAAGGGGCATGCCGTAACCACTTCGAAATGTCC
GAGTGCGCGGACGAACGCCAAAATTTACCCCCCTCTCCACAGGTCATTTTGTATCGCCCCAAAAACCGCTTGTGTGCCTTCTCGCGAGACAAAAACACAA
GGTAGGCTCGCGGATCTGTTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGTGATAGCATTCACCATCTGTAATCAATGCAGAGCCGG
ATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGATTGTCTGAAAAGACGATCAGTCCTGCACGCAATAAAGCGCGCAGCAGCT
CGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGCCGGGCACGCTGTTTAAGTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCTCCGTAGGCTGG
CGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCT