Description :
From Genome Similarity Track
Location :
Scaffold_456:1060- 2360
Sequence
1300 bases(100 bases per row)
GTCGTTCTCATTGATGGCGCCGAGTACTGCTTCACGAGTGCAGCCCTCTTGTCGCTGCGTGTGGAGGAACCGGACGATGTCACAGTGTTTGTTCTTCGCA
GCGGCGTCGATGGCTTCGCGAGTGCAGCCCTCCTGTCTGTTCTCGTGCAGGAACCTGACAATTTCAAAGTGGCCGTTTGCTGCAGCACCGTCCATTGCCT
TGGCTGTACAGCCCTCCTGTCGATTCTCGTGCAGGAACTTGACGATCTCAAGGTGGCCATTCGCTGCCGCATCATCCATAGCCTTGGCTGTGCAACCCTC
CTCTCGGTTCTTGTGCAGGAATATGACGACTGACAGGTGACCATTCGCTGCAGCGTCGTCCACGGCACTCGTGGAGCACTTGCTCAGCCGTCGTCTCTCG
TGCAGGAGCCGGACAACATCGAGCGCGCCGATCGACGCTGCAAAATTGAGCGCATCGTGGTTCCTGCGAACGGAACGCTCGCTTCTGCTCTCTGGCACGT
ACTCCACCATCGCCTCGTAGTCCATCGCACCATCGTTATCATCTGCAGCAAAGTCTATTGCATCGTCATCATCTGCAGCAAAGCCCACCTCACGGTAGTC
CTCCTCTCTGTACATATCATGTCTGCAGTCCCGCACGTTGTCCAGCACAAACGCAATGACGTCAAGGTGACTGTTCTCAGCCGCTGCTCGGAGCAGCGCT
TCCTTGCACTGGATCTGCAGCTCGGGGCTGTCGTGGACGAACTTGAGGAGGTCCAAGTGGCCTCTGCTCGCAGCGCCATACGCGACGCCGTCGCCCAGAC
GAACCCAACGACTGAAGAGCCACGCGACGATCGCAATGTCGCCCTGCTCGCCCACCGCGCGGTGGTCGGCCTCACTCGTGAGTCTGTCGTAGGAGAACCT
ATCAAAACTGGCATCGATCCAGTCGAGCAGCTCAAAGTCTTTCGTGTGGACAACAGCGTAGCCCAGGATCCCGGAGAGCACGCCACCCAGTCGTCTCCCC
AGGGCAGGCACTTGCGAGAGCTCATGGAAGGCGTTGAGCGTCGCTCTGTCGCCAGCGCAGACCGCATTCTGCCACAGCACGACGTCTTCTGGCGGGACTG
CGCCGCTGGCCGTGTATGATTTGCTGGTGCAAATGAGCTGCTGCTTGACCACGTGCGCAGAGTACGAGATGCCGGAGGAGTACGCCACGACGGACACCAG
CAGACTGCGGTTCGTGAGTACGTTCAGCGCCGCCTCGTCCCCCCATTTCCTCGCTGCAGGCCTCATGACACACGCAGAGAGAGAGAGAGAGAGCGCGCAC