Description :
From Genome Similarity Track
Location :
Scaffold_4710:106- 1821
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4710-snap-gene-0.1DNA mismatch repair protein Msh2

Sequence
1715 bases(100 bases per row)
CGGGATGAAGTCCACCTGCTCCTGGAGCTCCACGCACGGGTGGCGAGCCGCCGTGAGTACCACGCAGTCGCCCTCGTCTTCGAGCTGCGGTCGGCAGTAG
CCCGAGCCGGCATGGCACGCTGCGTGGGCGAACCCGAGCAGTACGTCCAGCTCGGCGAGCGTCGCGGTCGCGGCCTCCAGCACGGGCACGTACGTGGTCG
CCACGTCGCTCGCGGCGTTGAGCAGGCTCGACTGGCGCTTCTCGTATTCGCCCTTGATGCGCCGGTGCTCCGTCGCCAGCGCCTTGAGCTTCGTGGTCGT
GAACTGCACGCCACTCACGAGCACCTGGCAGATGTGCACGTACGGCAGCTTGGAGATGCGCGCCTCCTCCTTGGTGTTGGTCACGCGGAAGACGAACTCG
CGCACCTTGTCCTTCTCGCACTTGATGTCGCCGCCGATCGTCTCACGCGCGCTGCGGTGCTCGCTTTCGATCTCCGAGAGCACATCGTTCCACTCGCTCC
TGAGCGCCTGGAGCTCCTCGTCGTGCTTGGCGTTGATCACGAGGTGCGGGCGCGTGTCCAGGTCTACCACTTCCTCGATCAGCTCGACGTAGCCGCTCAT
GTCCTCGACTATCTTCGCCAGCGATTTAGTGTACTGCTCTTCAATCAGGGTCGACGACGAGCCGTCGTAGTTGCGCAGCAGCCTCAGAATGCGTGGGATC
GCGTCCTTCGCAGCGTCGTACACGGTCACGAGGTCGTCGATCTTGACGTTGCGCTGCTTCTCAAGCACGACGCTCAGGCGCTCGAGATCGGGCAGCGACT
TCATGCACTCATCCAGCAGCTCCATGCGCAGCGACGCGTCGTCAACGAACACCTGCACAACGTTCTGGCGCTCCTCGATGCTCTTGAGGTCCACAAGCGG
CTGGCGGATCCAGCGCTCGAGCAGGCGCCGCCCCATGCTGGTCTTGCCGCGGTTCAGAATCTCCAGCACGCTCCCGCCGTGACGCACGGTACCCTTTACG
GTCGGGTCAGGCAGCAAGTTGAGTGACCAGATCGCTGCGCTGTCGAGCTGCATCGCAGACGACAGGTTGCCGCCGCTGAGCGTGTAGCACCCAAAGTTGT
CGGCGTCCGCCATGAGCTCGAGCGCGTCGATGAGACAGGCAAGCGAGCCTGTCGCGAGCTCCATGTCCAGCTCATTCTTGTACGACGCCATAGAGGCCGC
GCCGGTCAGCTTGCTCAGGTTCGCCTCGAGGTTCGTCTCCTTGAACGAGTGCTTCTTGATGTACACGTTGCCGACGTCCAGCGTCTTGAGCAGCGAGTGG
AGCTTCTTGCTGTCACCCACGTGCGGCTCCAGGCCGAGGTCCGCCGGCAGGTAGCAACGCGACGGCACGATCTGCACGAGCAGCGTCTCGAGGTTCGTGA
GTTCGCTCGAGTCGGAGAACGCAAAGAGCACCAGCTCCCAGTGCTTGGTGTCCTCGCCGTCTTGGCCTTTCACGCACGAGCGGCGCAGGCGCGGCCGCCG
CACGGCCACGCCCACCTGCTTGAGGTGCTTGCTGTTCTTGATCTGGATCGCGATCTCCGGCTGCGGCGCGTCGTCCATGTCGCTGCTGCCCATGCTCGCT
CGCTTGCTGTCGTTGCGGGGAGAGCGTCTGTGTGGGTCTTGCTTGCGATGAGGCTCAATTTATTTTTGGCCAAAACAACTATCGTTTTTTTTACAAAAAT
AGCCGCGTTAACTTT