Description :
From Genome Similarity Track
Location :
scaffold_7:105967- 108882
Transcript NameFunction/comments
Plaha_PHALS_03482hypothetical protein L916_12250

Sequence
2915 bases(100 bases per row)
CTTTATTTGAAATCTTATGTCATCTCGAATCCAGCGCCGGCTGAGATGGACGTAAGCAGTTTAGCACGTAGTACCTTATACGAAGAATATGTGGGAAGTT
TTAATGTGTTGAAACACGTCGAAGAGCTCGGCAGAAGCTCGTCGTCGTTTTGAACCGAAACCTTTTGAACGCAAAACTGCGGGGTGAGCGAGGCGAAGCC
TAGTGACGGAGCGCGTTGACAACTCGTTGTAAAGCGTAAGAACGCTGCCTGTTCAGACGGCGTAAAACTCGCTAATGCTTGCCACAACCATGCTACACGT
TTGTCCATAGCGTAATAGCCACCGGTGTACCGAGTATTCGCCTGGAGGTCGTCAACGTCGATCTTACCGCTTTTTCCAGAAATAAGCACTTGTAATTCAG
GCTCATTAAACATCTGAAGCCAGCGTGGGTCAATCAGATCCGATAATCCCATTCGAAAAGCTGCACACTGTTCACGGATCTGAGTGTTAAGATAGTAATT
TGCAACAAGATGGATGTACCGCGTTTTGTTCCGATTCGTCACAGGTATATTCCCACCACCAGGAATAATCTCAATCTCCTTCTGCTCACCAAATACTTCC
TGAACAATCGTGTGCGTTAGACCAAGATCCTCGACATCTCCTTCATACGACTTGAGAAACATCAAATTCTATTCAGCAGTACCAATTTTGAGCACACAGA
TGATGTCAATATACAAGTCATACTCACCCTGTAAATTTCAGGATCCAATGACGGCAGCTCATTCAAGTGATTGAATGAATGCAAAAgttttgaaagaaaa
aagTGGGCGAATTTCGGCTGAACCACAATACCTTCATAAAGAGCTTTTCCCAATATTCGACCAACAAATTGAAACATTGTTAAGTGGTCGCTTTCACGCG
AAAAGTGACCGGAAGCTGAACTAGGGTTTGGATAAAGCAATTCATCGTGAGTAGTTAGGAAAAGGCCATACTGCAGATCGAACGCTAGTGTCGACAAATC
CAGCCAAAACTCTTTGAAGAGACCACCCGCATCAATTCCCATTTCCTCACGTCCAGCAGCATTCACAAATACCACATTAATGCGCTTTTTCAGATTTGCT
CGAATCGTGTTTAATTTTCGTAGACCATCTTGAAGAATAGCACTACGATGAATTCGAATGCGGTAGACTGAGGAGTTTTCGTTTTGGTGTATCTCTTTGT
CGGACTTGACAAGGCGTTGAAATAGTTTGACTCGTTCACTAAAAGGTACAAGATACGGCATCGATTGAATGAGCTTGTTTGCTCGCGGGGTTCCAAACAG
AACCTCTTCAATCAATTGGCTACTATTAAGCTCGGCAATGATCCTACGGACATCATATTAGTCTGTAGCTAACAAATAGATGTAACTAGATCATTAGAGC
AGCGTACCAGCTCGTGACGTTGCAAAAAGGCTGCCGAGAACATCGATTATAAAGAACTCGCATCAACCGAGTCCCCATTTCGACGACAAACATACCAAAT
GCAACGGACTCAGTCGAAGGTGCGAGATGAGCGTACGTCCAATACGCTTCATAAAGCGCATGCTTTAGACTCAGTACGATCCGCTCGATTTGACATAGCG
GCAGTGGATACTCTTGTTCGTACATCTTTCACAGCACCAGACAGTATTAATACACTTTTATCACTAGAGAATTTGTGCCGTGGTGCAAAGCTTCAcctct
tcatcatccattACGACCAACAGGTGTTCGTACGACATGCAAAACAGCAACAACATGCACACGTACGGGTCAGAACTACGTGCATGGATCAAATCGACAT
TCTGCCATACATCATGTTGTTAGCCCTGTACGTCTAAGCAAAATTATTTGCTATATCTTCACTCTACCCGCGCATACACTTCAAAGTTTTTAGTGTCTTG
CAATACACACCACAGCATCTCTACCAGAGAGACGCATTGCGTTGCATTTTCCTCACTTTTGACAGTTTCGACATGGTAGAATGCCAGCGTATTGAGTAGA
CGCATGGCATACGATTGTCGCTTACCGCCATCATTCCCCCATCGAAATAGAAATGTCCCGCATAGACAGGATAGAGCCTTAACCTTTTCAAGTTCAAAAG
GACCTTGAGCTTTTGAGAGCattgcagtcgctgcatgctgaGCTATAGGGGCTGCTGGCTCTTGGTCATCGTCAACCTGCTGCTGCATTTCTTTCGAGGT
ATTCGTAAACTGCAATTTCTCATCAACGATAAACCGTTCTCCACTGTCATCTTGTCTACGCCGCAACCCCGCTTTCTGTAATAAGTTACGGGCCCATGTC
GCTTTTCCGATTGATTTCACTTTCTGCCATGTAATTGAAAGTGACGTTGATAATGATGAGGCAGAAGCGATATCACCAAAACCGAATTGCTCCTAAACAC
ACAACATTGGTGTTACGATAAAGATGACTCCAAATTGGGTGACTTTGTCATCCTTACAGCGATCGTTGATGCTTCAGGGTACATTGGTATCGGGCGCTGA
GTTGCTAGCGGATGGCGCAGAGCGCTCGGCGAAAATGAAAGAAGATGATTGCACATTGCGCGCAAGTACTGATCATGTACCAGAATTCGGAGCTGCTCAT
TCAAAGCGTCCGGAAACACCACGGGCACCGAGTGAGACTCTGAAACTTTTGTCCATGAAACTGCTACGCCAGATGCAGCATAAGTTACTGGAGGCACTGA
CTGCAGAAGCTTAGATAAAAGCTGAACTTCGCTCAAGACGATCGCGTCACTTTTACTTTCCACACTAAAATTCATGATCTGTTAATTATTTTGATTATCA
ATTAAAGTTTGTATGTACTCACCGCTCAGATAACCAAAGAATATTTCCGAGAAGCCACGCTTCTGATGCAATTCCTGAAACGGGCGATGCGGGAATATCA
AATACTGACAATTGC