Description :
From Genome Similarity Track
Location :
Scaffold_13:10595- 12352
Transcript NameFunction/comments
Phypl_g559hypothetical protein
Phypl_g560hypothetical protein

Sequence
1757 bases(100 bases per row)
CATGTCCTTCGATGCTACTCACTCTGGTATATGGGACAACTTCTCATAAAAGAAAGCAGGAAGTTGATGCATCAGGGATGATGGCAAGCGCAGTTTGCGG
CGTTGGTCACCGAACTGTGCGTCAACAGCGTCGTCGGATAATGGTTCCCTACGCTATTTGTTTTGCGACAAGACGCCCGCTGCACTAGACATATGAGGTG
CTCAACACCTTCTTCCAGTCCTTCTCAACCCCGCTGAGCGTGCGTTTGGTAATAGCTAAGCTTAATAAAGAACGCCACCTGCCAGCAAGCTTGATGCGAG
CTTGGTGAAGGTATCGCAGAGCTTATCATCGGGGGGGGATGCGTGCCATTACACGAAGAAGCTTCACTGGAGCCAGGTACGTTTCGCCAACGGTATCCAT
GAAGTCAAGTTTGCATCCCGTTTTTAGCTTCAACATAAGGATTGGAAATTCTCAATAAAACCTAAACAGGCGACAATAAAATCAAACGTTGGACAGACGC
CAAGGCAGCGagcatggaggagctgcgcacgctgctgcgagacgccgaggaggcccagctgcagacgctgcaggcggtCGCGGACGACTcggcgcaggtg
gcgcgACTGAAGGGCcccgtactgctgctgctgaacgtgCTGGGCCAGTGCGAGACGCCGCAGACGCGGCGCGAGacgctgcacgtgctgcgccgcctgt
TCGCAGCGTGCTCCGCCCACTTTTACGACGCTCAGGCCTTCTTGGAGACTCCTGCGGACGCTACGAGGCCTCAGCGTGTCGCGAAGCGAGGGAACGTCGT
ACTGAAGGCGCTGCTAACCGCGCTGCGGACGCTCGGCAGCCAAGATGAagtggacgaggagatcgtccAAGCGCTCGTGGACATGGTGCGCGCCCTGTGC
CTGCAGTCGATGAACGCCACGGACGTGGTGGCCCTTTTCGACTTCCTGCGGCTCGGCCGGGCGCCGGCGCGTCGCTGggtgctgcagatgcagaaggcgc
tcgtggagatggACACGCTGCCTCGTGCGATCTTTACTATGAGAGGACCCAATGCCGGGCTGATCGTGCCGTCTGAGCAGCAATTATTCACGAGGAGAGG
gtacagctgcagctttggcATTCATCTGgatgcaactgcagcgactgTAGCGCTCTACAGTTTCCGAGGACAGAATGGGCAGGGTGTGTCGGCAATGCTG
GATGGGAAGACGTTGGTGGTGAAGATGGTTGCGGGGCAGGGAGCTGTTCAGCAGCTGGATGTGCCGTTTGCGGAATATGTGGAAAAGATGGAGAGGGAGT
GGGTGCACTTGTGCATTGTgcacgccaagaagatggtTTTCAAGGACAAACTGACGGTGTATGTCGACGGTAAGAGCGTGTTTAATGGGAATCTAGGGTA
CCCGGATCCAGTGATGATGGTGGGCGGACGGAATACTATTGGAATTGAACCTCTCGTGGACGGTTTGAAAGGAAAATTGTGGAGCCCCACGCTTTTTGGC
GTGGCGTTGTCGGAGGCTGAAGTACTAAGGTTGCATTGGCTAACTCACTGGAAAAGTGATTTGAACTCGGTTGCGGCTGAGAACGCGGGGCTGACAGATA
AATCCAAGCTTTGCTTTTGTTTCGATGCGCGGAGTTGCGACATGAACAAGCGTATTTGCTATGATGTTAGTGGCAATGACTGTCACGGTTCGCTGGGGTC
TGGAACAAGTGCGTATGTCACTCAGAGTTTTGTCCATGCACTGGATTCCGTCGGTGG