Description :
From Genome Similarity Track
Location :
Scaffold_7:1059432- 1062686
Sequence
3254 bases(100 bases per row)
TACTTCTTAAGTCGCCCGACGTAGAACGTCGGGTGTAGTCGTAGCGACGTAGGAATGTCTAGCGTGTAGGCATCACTCATAACTTGTAGTACTTTGAATG
GCCCCATGTAGCGCGGCGCAAGTTTGCTCGCACCTAGGTTCGTAATAGCAGAGGAACAAATTCCATCCGTTGAGAGTAATACACGCTCACCAATCTTGAA
TGAACTTGTGTTTTTGCGGCCACGTTTGTCAGCGTTTTCCTTCTGCTTGTCAACCGCGAGTTGTAGGTGCGTCACGAACGAATCGGGTAAACGATTGGCG
ATGAAGGACAAAGTCGGATACCGCTGCCTTGTCAGCGTGTCGCGCTGAAGGTTTCGGCGCGTAGTTAGCAGCAGTCGAGTGTGGCTGTGCTGGAGCGATC
AGCGTTCGGTGTGTCCAGTCAACTAACGGCGACGACGGGGATTGCGCGGGTGCGAGGATCTTCTTCGACTGTAAACGCGTCACCGCGTTGATGTCTACTG
CAGGAGTAGCTGAGCTCGTAGACGGCAGAACCGTTGTCTCACCGGAAACCGGTGGTTGAGCCAGTATCAAAACCGGTTGGGCAGGGTTATCGCATTCCAC
CCCCTCCAGAGTGAAGCCATCCGACGCCGTGGGTTAGCCCACAGCAAGTTGTGCGAGGACACGTGGATGACGCGCGTTGTTGACGAAGAACGGAGTCAAT
CCTGTCGACGCGTGTTTGGCATTGCTGAGCGCAAACTCCGCAAGAATCAGGAAGGAACTCCAGTTCTCGAAGGACGGGGTGTAACTGCGCAGAACATCTT
CAAGCACGCGGTTGACGCGTTCCGGTTACCCGTCAGTCTCCGGGTGCGCCGTCGACATGAGGAGTTAAGTGCCCAGGAGATCGAAGCGTTTCGTCCAGAA
CGCCGATGTGAATCGGGGATCGCGATCAGAGACGATTGATTCAGGAAGGCCGTGGTGTCGGAAGACAGCGTCGACAAAGTGCACCGCGGTATCGGCCGTG
GTGATTGAGTCCGGAACCGGAACGAGATGGCACATCTTGCTAAAGCGATCCACGAAGACCAGAACACCAGTACGACCGTCAGTATCGGGTGGGAGACCGA
ATATGAAGTCCATTGACACAGAGCGCCACGCCTCTGTCACCGAGAGAACGCAGCGGAGCTTGCGATGACGGTGACGGTTTAACACGTTGACAAGTTTCGC
AGGAGCGGACCCACTTGCGCACCCACTTGTATAGGTGAGGCCAGTAGAAGTCGCGGGATACCGCCGCGAAAGACTTCTCACGGCCCAAGTGGCCACCCAC
TGGAGCGTCATGGAATTCGTGTATAATTCTCGCACGTAGATCGGGAGCGTTGGGGGCAACGATGCGAGGAGCATCGAATTGATCGATACTGTACATCAGC
AGATCACCGTCAAGTTGGTATCTGTGAATCTGGTCGCGCGTGGAGCGGCTCAGTGTCTTTAGCGTGGCATCACTTGGTGTGCGAAGGTGTTCCAGGATAC
CGGCATATATCGAGTCATCTCGATACGCGGCAGAGATCTCTCCCCGCAGGGGAAGTATTGGAGATACCGCCGTCATCAGGTTCATACCTGCGGCCACACA
TGTGGCGCAGTCAAATTCGTCGTCGTCCTCGTCTTCAGGTGCCTGACGATCCAAATATCGGCGTGGATCGTAATCGGGGCGCCGAGATAAGGCATCCGCA
AGGATGTTGTTCTTGCCTGGCTTGTAGTGAACGACGAAGTTGTACTCGGAGAAGAATGACAGCCATCGTGCCATGCGCTGAGAGAGATGAGGGCTCTTCG
TCGCTGTTCGCAGCGACGCGTGATCTGTATAGATCGCGAATGTCTGCTCACCGAGTAAGTACACTCTGAATTTGATCAGTGCGTAGCGCATCACAAGGAG
TTCCTTGTCGTGGACCGGATAATTCTTCTCGGCGGGCTTCATCTGGTAGCTCACGACGCGTTCTCGACCTTCGTCGTCGAACCGCATCAGTGCACAGCCG
ATGGCGAAGTCGCTCGCGTCGCAAACAACGTGGAATGGCTTTGAGTCATCTGGAAGCGCCAGGATTGGGGCCTCCGCCAAGCTTTTCTTCACTGCATTAA
AGGCTGACTGATGCTCGGGAGTCCACCACCACGTGATGTCTTTCTTCAGCAATGAAGACAATGGCTGGATCAGACCAGCGTAATTTTTCGTGTACTTGTG
GAGATAATTTGCGAGGCCAAGCCACTGACGCAATTCAGTCTGATTCTGCGGCGTGGGCCACGCACAGATGGACGAGACCTTCTCGGGATCCGCTCGGACA
CCGTTTTTGCTCACATAACAGCCAAGTACCGGAATCTCCGGGGCACAGAAGATGCACTTCTTCAAAATCGCGTACAGTTCGTTTTCGCGCATGACTCGGA
ACACTTGTCGTAAGTGATTCAAGTGAACTTCTGTGGCGCTGAGATCGCCCTCAGCGCGGCTGTGAACGAAGATGTCATCGAAGTAGCTCGGAGCGAAGTC
GCGAAGTGGGCGCAGAACGTGGGAAACCATGCGATTGATTGTGGCTGGTGCGTTTTTCAGGCCCTGCGGCATGACAAGCCACTCCCACAGCATCCCGCTG
GGAGTGCTCACCGCTGTGAGCGGGATGTCGCTGAGTCGCATCAAGATCTGATAGAAGCCATCGGTCAGGTCGATGGCGCTGAAAATAACACTGCGGCTCA
TGGTGTCAAGTACCATATCCTTCCGAGGAATCGGAGTTTGTGCTGGGATGGTGGCGTCGTTTAGCTTGTTAAAAGCGTGAACAATGCGCCAACCACCCGT
GGCCTTTTTTCACGCAGAACGTCGGACTCGAGTGTGGCGAGGTACTCTCGCGCACGTGACTCGCTTTGCGGCGGCTCTCGAAGAAGTCGTCAATGGATTT
AACTTGATCGCGTGGGAGGGGCCACTGTTGCATCACACAGTACTTGGAGCCCGGCGTGAGATCAATCTCATGACGAATGCCTCTGTCAGCAGGGAGCTCA
GCTGGAATCTTGTCGGGAAAAACATCCGCGAACTCGCGGACGGTGTCGTATACTGGATTGCCCGAGTCGCGGAGTGACTCCCACGACTGGGCAGCGAAGC
GCCCTTCGCGCGCCGACTTCGGCTCAGCGTTCTTTGGGCGAAGTGGAAGATTGTCGGTAGCGACCGTGTGGATCTCTTCCGCGAGGCAGACTCGGTGATC
AAGCAGACCTACTCGATGTCTCCTGAGTTCAGATCGCGCAGAAAATGCTTCCAG