Description :
From Genome Similarity Track
Location :
Scaffold_532:10591- 17240
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_532-snap-gene-0.630S ribosomal protein S16
Pytul_var.sporangiiferumfgenesh-pug3_contig_532-abinit-gene-0.28Nucleolar protein

Sequence
6649 bases(100 bases per row)
ACTAAACCAGAGCAAAAAAGGCGGCACTTTGTATCAGCTACATACATGACCGACACACGCAGAAACGAGTGCTTTCGATATCGTCGCAGTGGATCATGGC
GTGCTATTAGAAGAGACCGCTGTATCATTGCATATCCTCTCCCGTAAGGAGCGCTGCGAATGCTTACAATAGTACGCATGTGCCACTTTGTGCATTGTCC
TGCATATCGTCCTACTTAGGACAAGCTTCTCCTAAGCGTACTTCCCAAAATCACTAAAACCACTATGATTGGCTAAAATAGTGTGGGGCGATCCACATTG
CATCCGTACCAAAACACGGTAACCTTCACCCTGTCCTTGTGCCACTTGAAGGTACATGCGATTTAGTGGTGGAGACTTGGGCTCTTTTCCTGTGCGCCAA
CGACCCACTCAGCGCCTCAAGCAAGGGGAAGAAGCACCACGCCAAGCAGGAAAAGACGAGATGGTGGTGAGACTGCGACTCGCGCGCTGGGGCCGCAAGG
ACCTCCCATTCTACCGCATCGTGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGCCACGTGACGGCAAGCACCTCGAAATCGTACGTCCAGCTTG
TCCTTCTCTGTGTCGAATTGGTGCTTAAAGCCGTGGAACGAACGCATGACTCATCTTGTTCTCTCTCTGTTGATGGTGGTATAATAGTTGGGCACGTTCA
ACCCGATCGCCGCGGCCGATGGCGTGAAGGAGCTGCGCGTGAACAACGAGCGCGTGCGATATTGGATCTCGGTCGGCGCGCAGCCGTCGGACCGCGTGAG
CCACCTGCTGGGCATTGCCAACATCCTGCCGATGCCACCCACGCGCCAGTACGGCATCAAGAGCATCCCAAAGAAGGACCGCGCGCCTGCCAAGAAGTAA
GCGCAAGAGACTACGAAGGGAGCCATGTACCAGACGAAGCGATGCAGGCGATAGGCACGCGCGCAGGATAGAGCAGAGCACGGAGCCCTAACAGACAGAC
AGAAGCAACAACGAAGCAATTGCGCGACGACGAGCGCAGTGACTAACTGCATCAAGCATATGCACAAAAGCAATAAATAAAAACAAACAAAACACTGATG
ACCATAATGCGAAAACTTAGTGGTGTATATAATAAAACCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGAGCTCTCGCACAGT
TCATGCACAGCGTACTCAGAAGCAAACAAAAAAGCAAATCTAATTATCCAGTTTATCGTTTTTTTGGGGCGCCATCGCTTTCTATTTCTTACTAATGCGT
CGCTTCTTGGCCGGGCCTGAGCCGCCGCCCTTGAGCATGTTGCCGCCCTTCTTGACCTGCTCGTTGAACGTCGCGTTCTGCTCCTCGAGCCATCGCCAGA
TCTCCTTCTGCTTCTCGCGCTTGCTCTCCAGACGCGCGTTCTCCTCCTGCTGCTTCTCACGCGCCAGGAACTCGGCATCGCGGCGCAATTCGCGCGCAGC
ACCCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTGGCCTTGTCACGGTCCGCGCCCT
TGTCCTTCCGCAGCGTGTAGTTCTCGTCGAACTTTGGCGTGAACGTCGGCAGCAACGCCGGCGCGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTCTCGTTCACCCGAGTGCTCTTGCCGTCAAACAGCGAGCGCGTGAGCTCGTGGAGAAGCAAGT
AGATCGGGTGGAAGAGCTCGTCGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGACGACGCCGCCGCGAGCTCCAGCTT
GGGGAGCGTCAGGTCCTCGTCCTTGTTGGCGGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCGT
TCGCAGCGACGACGACTCCACCAAGTATACGCGCACGAGCTTCTTGAGGCACACGAGCACTTCGGGCGTGAAGCGCTGCTTGTCCTTGGTGATCTGCAGC
ATCAGCGTGCACGTGAAGAGCGCTCTCGTGGCATCCTGTCGACTCTCGAGCGCACCGTTCACGAGGCTCTCACCCAGCAGCGTCTCCATGGGAGAGATCA
CATTGTGGCGCAGATCCGACGTCGGGAAGATCTGGATCAGCGCCTTGAAGAGCAGCAACTCGGACAATTCCGGCCACTTGGACGGCGACTTGGTGCTGTG
CAGACGNNNNNNNNNNNNNNNNNNNNNTTGAAGAGGTTGATCAGCAGTTCGCGCACGATCACGCCCGCCGTGTCGCTCAACTGCTGCGCGAGCGCAAACA
AATGCTTGGCTAACCCGTCAAGCTGCAAGCACACAACGCAAAAGCACATTGTTAGATACATGCAACGTCCCCACATATACGCCACATAGACAAACAGACG
ACTTACATCTTCGCGGTGGACCGCGTACTTGCTCGCGTACTTGAGGAACTGTCGGATCAAAATCGCAAAGAAGCTCTTCATCTTGGACTGATTTTCGACG
CTCAGACGCGGCGAGTAGTACGTAATGATGCGCTCGACGATCAGCGTGCGGTTCGCGGCTGACTGCTTGGCGTGGTTCTTGAACAGCGCCGTGAGCTCCT
CGGGACTCTCTGGGCACGGGAACACGAACGGCAGCTCCTCGGCGGCTTCCTGGCGCTTTCGCTCCTTCTCTTCGTCGTCTTCATCTTCATCTTCGTCAGC
GTCTTCTTCCTCTGCGTCATCGTCTTGCTCCGCCTCCGCCGTGGCTTCTTCTTCATCACTGTCATCATCGTTAGACTCCGCTTCCGAATCCTCTTCCTCC
TCTTCTTCCTCTCCATCCTCTTCCTCATCTTCGTCCATTCCTTCGCCCTCCTCATCCTCGCCATCCTGCTCAGCGGCATTGAAACGCGAGTCCAGGTCAT
AGTCCGCGGACAGATCGTCGTCCGTTGGCGGCATCACGATCTGCTGCGGCGTCTTCTGCTTCTTCTTGCCGTCTTTGCCCTTCTTCCCCTTCTTCCCCTT
CTTTCCAGTGGTCTCGTCGTCACTGTCGTCATCGTCATCGCCCTTCATGCGCGCCACACGCTTCTTCTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCGATCGCGCTCCTTGGCCGCGGCTTCCTCGGGGGACATGCGGCGCTCCGTGGCCTTGGCCTTGGCTTCGAACGCAAACTCGCGCGTGAGCTTGTCGA
ACTCGTCCATCGGCGTCTTTTCCTGGATCTCCTTGCCATTCGATCGCGTCGGGCGGAACTCGAGCAGCGCGCGGATGTCGTTGAAGCCCTCATCCAAATT
GTCCGTCGCGTCTTCCTGTGCCGACTTGTTCTTCTGGCGCTCGGCCTTGAACATCTTGGCCTTGAGCATCACCTCCTGCATGATCTCCTTGTGCGACTTC
TTGCGACCATCTTCCTCAGGAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTCATCCTCGGCGTCCTGCTCGAACGCGGCGTCGGCGTTCAGGTTGTCGTAATCGTCGATCTTGGCG
CCACCGTGCGTCAAAAAGAGCTCGTCGTCATCCTCATCATCCGAGTCGTGAAGAGCGAACGCACTGGCGTTGCGCAGCTTGCGCTTGCGCTCGGTCTGGA
AACGCGCGATCATCTTGTCTTCGAGCGACATCGTCGGGTCCTGCTCACCGAGACGGCGGTCCTTGAACGAGTTGGCCTTGTTGCGCGCCTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGGCCC
TGACCCTTGATGCGCTTGCCGATCACCTCGTACTTGGCCTTGGCGTTACCGCGCACATCGAATGGATTGCGGCCCGTCGACGACGACGTGCGCACCACTT
TGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGCCACGAGCG
CCACCACCAGCGCCACGATCGCCGCCGCTGACCTTAAAGTTCCCGCCCTTCTTCTTAAACACCATCGTGCGCGAATGAATGCAGCAGCAGCTTCAAGCGC
CAAGTGTGCCAATGCACCAAGTGGCTGGTGGTTATTGCTGTCGCTCTTCCCAGCGCCAATCAAACAACAAGGGGCTGTATACAACGTTTCATGACACCAG
GGTGGTGGGTGATGGGTGGCTTTGTTTACTTACCGATTTATGGGTGGGTCGAAATCAAAACGCGATATTTGGGTGAATGGGTATTGGTGGATTTGACCAA
CACCGAACTTAAGAGGGCCTCATTTTAAGGAACAAAAAGTTGCAGTCGAAGTCCCTCTATTTAATGACATGTACCCTAGTCCTAAACGGCCAAATTAACC
CTTTTGCAATCTTCACATGATAGATAGTAACTTAGCACAAAGTAGTCAAAAAATTACATCATAAGTCTACCCATACGCGTCTACTTATACCTTTCGTCGA
CTTTCAAGCGGTACAGTGGGCAGTCCCAGTACCGTGCCCATCCCTATACAGTCGCCCCGCGCATGTTCTTATCTCCAGGTGCGCGTCAAAAATTACGCGG
CGGTGGCTGCTGTGGAAAGCTCCAAACTAAAAGGAAAGCAGGTCATCAGAACGCAGCCACGCGCGCGCCCAGATTCACTCCACCATTCCGCCATATACAC
GCACCTAATCCTTCCTTCCTATACACCAGCACTGACACACGCCATGGCCCACGCGCAGCAGCATTCAGTCTCGATGCACGCGCCGCTGGACGACGACGAC
CTGCGCTTGTCCCTGGCGCTGGACGCGCTCGATGACGATGACTCGACTGGCGCGCACGACGTGGACATGGACATGGACGGCTTGGAAGGCGTCATGGGCG
ATGCCCATTGCAGAGACGCGGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGCGTTCTACAGCTACTCGACGTGCTTCCAGTCGGCGTCGTCGGAGCTCGTGGAAAAAGAT
CTCGCCGGCGGGTTTGTCNNNNNNNNNNTGAGCAGATGCTGCTGAACGAGTCGGAGGAGTTTATGACGTCCCAGTTCACGGCAGGCGTGAGTGCGGGTGG
CTTGGATGGCGCAGTAGCGAGTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACGATGCTCCGCGCAGAGATCACGGCGCACCATTTCCGGCATAAGAGCAATAGCGCAATGAGTA
GCAGCAACTGTGCTAGTACAGCTAACAATGCGCAATTGGTGCTGCTGAAGCAAGCGATTGCGAGCTCTGCGGTGCCGTCGTCGTCTATATTCAACATGCC
ACCGAGATACTTTGACACTGCACAGAGCTCCCCACAGAAGCGGCGTGCGTACCGACGAACGTTTGGCGAGCGAGCGCAGCCATTCGGCTTTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAATTACCAACCGCCATCATTGAGTATGAAGCACGATCCGCTGGCGGCCCAGCACATGAATCAGCATCAC
CATCATGCTGCTAGCACTGTGCATGGCGAAGAAAACCGTCCGCCACCAGTACCAACTGCAGACAAAGTCGACGAGAACGACGGCGACGATGAGATGGTAC
ACATTAAAGAAGAAATTGTGGATAACACGCGTTTTGTAGCCGCTCGCAGTCTCGTTCCAGTGACAGCAGATGAATCCATGGACGACGAAGAGAAGCAACA
GTGTGTGGTGATGAAGCAGGAGAGAGTGCAGCAGCTGTCTTTCACTGGCTTCCGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACGCCG
ACGAGCATTTTCGCCGTGCCACGACGCCGACTCCTTACATGCCAACTATGGACGACGAGGCCACACTCCGAACCCCATTGCGCCGAAGCGTGTCGACGCC
GATGCCGGAAGTGTTGTCTGCTTCTTCGAGCTATTACCAGCACCAGACCCCGTCGCAACAGCACGCTGCGCATGGACTCACCAGTCGGTCCATGTCGCCG
GCCGACGCCTTTGAGAAGGTCGCCGTTGTTGTGCAAGTCGCCAAAGACTCACCCGCCCGTATGAACAAGTTTGAGTGGAAGATCGGTGGCTCAGCGCGAC
CAGACGCGCTCAAACGACAATCGCAACAGCAGCAGCAACAGCGAAAGATGACGACGCTCTTAGCTGCGGAACTCGGGAAATTGGATGGAGACATCTGTGC
ACCAGCAGCAGCAGCCGAAGGGGCTGCCTNNNNNNNNNNNNNNNNNNNN