Description :
From Genome Similarity Track
Location :
Scaffold_437:10591- 11737
Transcript NameFunction/comments
Phyta_totarag8284RNA polymerase II-associated protein, putative

Sequence
1146 bases(100 bases per row)
ACTCGTACGAAGTGGCTGGTGCCTTCTTGGGTAACTTGGGCAGAATGGTCGAactctttttcttcttcttttcgGTTGTCGCCTGCAAAGACGCTGTAGT
TGGAAGAGGCTGGGGCAGTGAAGCGGAAGCTGATCCTTGCAGCGGCGAAGATATCTGCTTGGTGCATGAAGATGGTTTCTCCGACTGTTGTGACTCAAGG
TTTTCCTTGTTCTCACTGGCATCACTGTCTTGCTCTGGACTAGGGTGCTTGCTCAGTGAGCTCTCTACAATAACTTCAATCGAGAACTCCGTGCGCTTTG
GTGAGCGCTTGATTGCCGTTCGAATAAGCTCTCGAGTCGACTGAAGCTGTGTCTGGATTTGACGACTTTTCGGATCCAATGTTGCGGCGCGCTGGAAGTC
GAGCAACGCGAGTCGGTGTTTTCCCAACGAGTTGCGCGCCGTACCTCGGCGTGAGTACGACTTGACATGCGTCGGATCAGCCTTCAGTGCCAGCGTGCAG
TCGTCTTCAGCATTGGCAAACTCGCGATTCTTCAGGTATGCCATCGCACGATTCGAGAGCACCACTGTATTCTGCGGGTTGTAGCCCAAACAGCGCGTAT
AGCACTTGATCGCAGCCACATAGTCGCCACGTTTGTAGTGCGCATTaccttcttccttctccaaTTCCTCTCGACTTTTAGTAGTCGCCGCAGTGGACAA
AATCTTGCTCGTTGCAATCACccgacgtggagctggtgaagcttCTACCGACGTCGAGACCTCCTGACTATTTTGTTTAGAAACATCCTCTTCACCTGCT
TCTCTCAGTGCTGCATCCTGCTCGAGCAAGCAGTTTTATCATTGTCAACTGCTTTgtcatcagcagcaagactCAACACAACGTACCACGTCAAACCTCT
CCCAGCGCTTGTAGCCTTTGTCGTAAGTGTGTGCGTCTGATTTCTTCCCATTGGGAGCACCAGCTTCTTTACTCGAATTGCTGTTATTCCCAACGCCAAC
GACTCTTGCACTCCGAGGCGGAGGAGGctcagttgctgctgcagaagtcTTCGCCGCTCGTTTGCGCGCTGAGTCTTCTTTGCCAATACTCTTCTCCCAC
GCGTACAGATCCGAGAAATagtcctgcagctgcgacgcaTTCGCGC