Description :
From Genome Similarity Track
Location :
Scaffold_300:1059- 6264
Sequence
5205 bases(100 bases per row)
GCGCCTCCGGACCAACCCGGGACGGATCCTGATACGGATTAGGAGGCCAACGTAAAACACGGAGGAGTAAACAATTTGCGCGTTAAGTTAAGCGTATAGA
CAAGGCCTTTCTTGGACACGGCCGTAAATGGTCCTATTAAGCGAGGACGCAACTTCGTTATGAACAGCGGACACTACAATTGAAGGTGGGTTCTAAGCGA
TTAGTAAGCCTTAGTCACCGACCTCATAAAGTCAATACTGCTTCTGCCTTTAGCATCCGCTTATTCCTTCTGTTTGGTTTGTCTATCAGCCATTGCGTCA
TGCACATGTCTTAAGACGTTCAATCGCGTTGTGAGGAACACGCTAACCGGTTTTTGAACAGTAGCAGGGCTGACATCAATAAGCTGATCGGCCACCTCTC
CCCCATCAAGCCCTGAGCCACATAGTGGTAGCTTAACGGAACGCGGGGGTGGGTGAGGCCGTTCACGTAGAACGGAATATATCCTATCGAGGCATGGACG
GCATTGTTCATAGCGAACTCAACAATGGGGAGCATTGAGCTCCAACGCCGAGGCTTCTCAGCGCATGCGATTGAACATGCTCAGTCTGACCATCGGTCTG
CGGATGATCCGCTGTGGACATGTCCAACCGGGTGTCGAGCACCTTGAAGATGGACTTCCAAAACTTCCCCGTGAAGCGGGGATCGTGGTCAGCGACAAGT
GCCAGTGGCAGTCCGTGTTGTCAAAACACGCGATCAATAAACAGCAAAGCTGTACCTTCACCATCAATCGAATCAGGCACAAACGCTAAGTGAGCCATTT
TGCTCAATCGGTCGACAAAGACCACAATACCTGTGTTGCCTTTCGAAACATTCGGTAGTCCAAACACAAAGTCCATGCTGATGGACTCCCAACACCCAGA
GGGTACAGACAAACTAGCCAGCGGCGCAGTCACATGTGTCGAGGGTTTAATTCGTTGGCACGTCTCACATGTGCTTACATAAGTGCTTACCCATTTATAG
ATATTGAGCCACCAATAACTCTGGCTTTTTAAGTCCTAGGTCTTCTGAAGACCGAGATGACCTCTAGTAGCTCTGTCGTAAACCTCATAGAGGATACGAT
ACTTCAGTTCCTCATCATGAGGAATAATTATACGCGGGGTATCCGCGGTATCAGTGCGATAGCATAACAAGCTATTATTAATAGAATATCGATGTAGCCT
CGCACGCGAACGTGCCGATGATTTAATGACCGAGTCTTCAAACTTATCGCTTCCTAGAGCACGTAGCAGAGCTACACATTGTTTATCCTTGGCATAAGAT
GCATGGATTAAGTCAGGGTTTAGGGTTCGTAACATGAGCAAGCTCATAGTCGGGCCTTCGTGACAGCGCATCAGCCAGCGTGTTGTGCTTTCCCGGCTTA
TACCGCACCTCGGAGTTACATTCTCCAAAAAATGAAAGGGCCATCCTTTGCGAGAGTTGAGGCGATTGGGTCGACGTGCGTAAAGGCGCATGATCGGTAT
AGACTACAAAAGGCTTGGAGCCAAGCATATGAACTCTGAATTTGACGGGGCATACTTCATAGGAAGTTGCTTCTTGTCGTGAACTGGATAGTTATTTTCA
TCATCTTTAAGCTAACGGGATTCAAAGCGATGACACGCTCACGTTCCTCAACACCTGTTTGTAACAGAGCACAGTCAATGGCAAAATCCGAAGCGTCACA
GACGACACTGAAAGGCCAATCAGAATCTGGCAAAGCCAAAATCGGGGCATGTAGGAGAATCTCCTTTACGGCCTAAACAGCCTCTGCTTCGGTGATAGTC
CAGCACCACTCCACATCCTTTTTAAGGAGATTGGAAATGGCAGAGCCACATCAGCGTAATTTTGCTACACTTGTGCAAGTAATTGGCAAAGCCAAGCCAC
TGCGTAGGTCTTTTTTTTGTTCCAAGAAACTGGCCGATCCAATATGGCCTCCACCTTTGCAGGATCTGCCCGAAGGCCTCGCTTCCCAATGAAGCATCCC
AAAACTTAGATCTGGTCCGCAACCAAAGATACATTTTGGTGCATTAAAATAGAGCTTATTAGTGCACATGCACTCGAGCACAGGTCGTAAATGGTCGATC
TGGTTATCTACTTCCGACCGACCCTGTTCCGCCCGACTATGGGCAAACGTGTCATCAAACTATGTTCTTGCGTACGCATGGTGAGGACGGAACAATTGCG
TTACCAGACGATTAAACGTAGCCGGGGAATTGGAAAGCCCCTGGGGCACAACCAGCCACTCCCAAAACATACCACTTACCGTACTAACCGCTCGTAAGTT
GGATATCACTTGCTCGCATGATCATTTGATTATAACCATCGACCAGGTCGAGTGCACTGTACATTTTACATCCTGCCATGTTGTTCTGAAGAACGTCGTG
TCTAGGAATGGGAGGTTTTTGCCGGTATAGTGTTCGCATTAAGCTCATTATAAGCATGCACAATATACCACTTACCATTAGGCATTTTGACACAAAATGT
CGGTGTGGAATAAGGAGACTTGCTCTCCCGCACCATTTCCACCGCGTGCTTAGCACTGAAAAACTCGTCAATGACGTCACATTGTTCCTTTACTAAAGGC
TACTGCCTTGTAACGCAGTATTTGGTTCCAGGAACCAAGTCCATTTCATGACGTACGCCCCTATCAGGAGGTAATACAGACGGTGGGTTATGACATACCA
CGTCTTAAAATTCCTTAACCAAAGGGTAGTAGGGATATCAAGAGTTCTTCGAAATAGATGATATACTTCTTGCACTAAGTGCCGCCTTTGTACTTTCAAA
GACCGTCTCATTCAATAGAGACGAGGAGTTTACCTCATTATCGCGTCCGAGGACCATCATATCGGATAAGTCGCCTGCCTTAAAGTCCTAACTGAACTCA
TCTACAGACATTTTTTCTAGCTCTAACAGAGCAGTTAATGATGGGAGTGCCGCAAGGCCAACTTCACCATCCACGTGACCTTTCACGCCATCGACCAATG
TATATAGCTGATCTCTAGTATCACTAAGCGACACTACAGACGCTTTTCGTCTCGCAGCCGCTATTTGGCGTCGCTGCCGTCTCTGAAAAGAGAATAACTC
CTCAGCGAGGGCGGACCATCTGGTCCTACAAGGTGATTAGCTTTTTCAACCTTAGCGTGCTCTAAACAAGAGCTGATGTCATTACCGACATCCCTTGCAG
AGTTACTTAACTCGAACTCATCACCCGGCGAGTTATCCGCCACTGTACGCACATCAGACTCTTGATGTCTAGGCGTCTCGCCAACAACTCCCTTAACGGC
CTTCAGTGAGATGCTATGATATCCGCCCTCACTCTGTGGATGTTCACGTGCCACTGCACATATATCTAAGGGATCACACCCTAAATGACTCGATCATCAA
TGCTATCAGCATCCAGCGGTTCATTGTACTGACTAGTGCCACTCAACGGAGTACGTGCCGTTTCACTATTGTCATTGCCATCAGATTCGACTAACTCAGA
CATTCCGATGTCCAGCACACTAACTGACTCAGCCAGTTGCTTGCGCCAATAGCGCTTTTGTTGTCTAGAAAAGGTGGGTTCATGAACCCAAATCTTCACT
AGAAACATTGCGCGTTGCCTCTAAGGTCCTGGACCTCCAATCAATTCATGGCTCGTGGCGTTCCAGCTGGACCATACCGAGAATGAGATCATATCTCGAG
TCCAAATCTAGGCCAAGACAACCTTCAATGCTGTCAAATTCCAAAAACATTGCACCTAAGTTCAACGGAACTTTAAGTACGGTGACACGGGCTCCCGTTG
CTAGACGCATCGTGATAATATCACCTTCATGCGTTTTCAGCGCTTCAGCATACTGCTGACTCCCTTCAAGGGAACGGCGTCGGACGTAGTTGCCCGATGC
TCGAGAGTTGATCAAAATTGACCACGGCTTTTCAGAGCCCTTAGCGCCGTTGCCGAGACAACCAGCTAGCCTGACTTGTATTCACGCTTCGTAGTAACGT
CCACGAGATCGTTTGGGAATAAGCCCTGTTCAGCGCTTACTCCTAGAGTCTCTACAAAGCCTAGTTCCTCCCCAGTAGGGCGCTCCGCGCCTACTGGAAG
TCGACGTTTTCCCGCACCGTACCAGGTTTCTGGTTTGAAGTGGTTTTGCGGCTCGGCCGATTCTGTCGCGGTTTACGCAATGGACAGTTAGGGCGTAGAT
TCTTTGTGCTTCCACACGTATAACATTTACGGATATTACATTGCTGTTACACAGCTTGAAACTCGTCTTCTTCATCATCCGCATGATTGCTATCTATGGG
CTAAAACCGGTCAAACGAACTTTGGGCACGCCCATGCGTACCATAGCGAGTCGCTTTGAAGTTAAACTCGTCATGAAACGATATGTCCACCGCCCCCTTA
AGAGTTAAGGGACGGACACGAAAAACTTCGGTCCTAGCAGCTCCAGTACGAAGGCCTCTCGTAAAAATGGTCACGCGGATTTCCTCGAAGAGAAGATGCA
ACTGCATAGCAGCGACAAGAGCTCCCAAATCTTGGACATAGTCCGACAACCCCCCCCCTTCCCTTGTCGTAGGATGATAAGCGTGAACGTACTCGATATG
CCTGGCTAGGTTGTGCAAACACGCAAGCCATCTGTTCTTTATGCGGATCCTGCGTAAGAAACACGGCGTCTATAGACGCATCACACGTCAGAGCCCATTC
TCTGGCCCTGCCGCCCAGTTTATATGGCTAGGCCAACTCTCTGCTGATCAGTTTGCAGCACAGCAGCGCTAATCGCCATTTCGACTTCTCGAATACAGAG
AAGGAGGTCTGCTCCCTCTTTCACGTCAAATGCCTTTACGCTCAGAACGAGCGCGCGAGCCTTAGGATCTTCATCGACCATAGGGATATAACGAGTCGGC
ATAGCCGACGCCACATGGTCATGAATCTGCCCGATTGGCGTGGCCTCAAATTGCATAGAAACTTCTAGCCGTGCATTGAGCATTTCCAGGCCTTGGGTCA
CAATATGGTCAATTTGTTCGACCCCAATCAACGCTCTAACCTTGTCGAGGGTGGGGCGTTGAGCTCAGGGAGACTGGCTTGGATTTTCATCTCAACAGAG
GTTTAGCCGATTTGCCACTACGGTGTAGAATTGACTACATGTGCTGCCAAGTATAGTGGATCTACACAGCTCTTAGTCAGAGGAAGACTTACGACTCTAG
AAGTC