Description :
From Genome Similarity Track
Location :
Scaffold_149:1059- 2294
Transcript NameFunction/comments
Sapdi_VS20SDRG_16714hypothetical protein

Sequence
1235 bases(100 bases per row)
TGGATTTCAGCTGCTGCCAAGGACCTCATGGATCGGATCCTCATCATTGGTCACTGCGGCAGTGCTGGACATCGCGGCGTTGCTGCGTTGTGCAACGCTA
TTGGAGATATCTTCTCGGTGACGGGCTTGCAGGCTACGTGCGAAGCCTTTATCAGAGGCTGTCTGCTGTGCCACCACACGAAGGGTCCTCGGATCATCCA
ACGTCCGTATGCTCCGGTTTGGCATGCTACGCGACGCAACAAGGGTCTACACTTTGATTTCCTCTATTTGGACAAGTCGGCGAGCGGCTACTAGTACGTT
CTCTTGCTCAAGGATGACCTCACGCACTTCTGTGAATTGGTGCCGTGTGTGAGCGCGACGTCGGAAGCCTGCGACCGCCATCTTGGATTGGGCGAAGCGC
TTTGGCATGCCGCTGACGTGGATCTCGGACCCAGGCTCGCATTTCAAGAACGAGGTGATGGCTACGCTGGCGACAATGACCAAAGTACGACATGATGTTG
TGCTTGCGTACTGCCCATGGTGTAATGGCACGATCGAGCGGCTGAACCGCGATCTGCTACAAGTCCTCCGGGTGCTGTTGCGTGAGTATCGTCTGGCGAT
CGATCAATGGGACTACCTTCTGCCGGTGGTGCAAGCGAATCTCAACCACACGGGGGCTCGAAATCGCCAACGGAGGTCTTTACGCTTTTGAAGCCGACGG
TGCCGTTGCACGTCATCCTCGGTCCCGACAACTCGATCCGGGACAAGTGCGACTGGTCGAAGGCAACGATTACCAACAACGTGGATGCGCTGCGGCTCAG
CCTCCACGAGATGCACAAGAAGATTCTCGATCTCAACCGTGAGCGCGAGGCCCGAAAGCTACTCGACACGAAGCGTGTGCATACGCTGAATGTTGAAGTT
GGCGAGTACGTGCTGTGGTCAAGGGTCGATGACATCCGTTATCCCAAGCTGCGCGTCACGTGGCTCGGACCCTACTTGGTGATTCAAGTCAACGAATTCT
CGGTCAAGATTCAACATTTAATTACCAAGGAAGAACGACTCGCTCACTCGTCTCGGATCAAGTACTATTCCGACTCGAGCCTCAACGTCACGGAAGACAT
AATCGACCATGTGTCGGAACAAGGTGTCATGCTCAAGGTGGCTGCGATCGCGGCGCATCGCAACAATCAAGCCGCCAAACTCTATGAGCTGCACGTGCAC
TGGGAAGGTCTGGAGGCGATTGAAGCCTCGTGGAA