Description :
From Genome Similarity Track
Location :
Scaffold_324:10587- 14561
Sequence
3974 bases(100 bases per row)
GACACCGGGCAGAGAGCCAGCGACACCACCAACGTTCAAGGGAGCTAGAGAGCACGCGCACAGACCGCACGAGCGCAGGAGTGCAGGAGAACGATAGGAC
AAGGACTTAGGACAAGCTAACATTTTAAACAGAGTTGATTTTACCTCCTTCTTCACAAGTGGTCTTCGCCTTCGCAATACCGGGCACGGGATATACTTTG
GCCCACCCGACGCTACGCAAGTCGACTTACACCCCAAGATCAAGGAACCAGGATAGCTTGGCCCAGCGTCCGTCAACCCTCACTTCGACCCACCGCTAGA
GGAAGCGGCAAGCAAGGAAAGGAAAGGAAGGTCACACACCGACCACAAGGCAACCCCAGGCCAAGATCACACCTGACCGGCGAGTGTCGATCTAGACAAC
CCCAGATCGAAACCGCCACAACTACTCCGGCACAGCGTGAAGCATATCCGCGTTGCTGCCACAAGTTCCCGCTGTCCACCAGACAGTCCAAGACTCAACC
CCAAGCGCGTCTTCTCGAGATCGCCCGAAGAGCGATCCAGCCCACCGACGGGTACACAAGGTGAGGATCAGCAACTTCACGGAAGATCGGAGTACCCCCT
CCGTTAGTCGGCAGTTCGGGCGCCGTGTGCAAGAGGACCCCCGCGATCTGCAAATTTCGCGGATCCACTTCGCCACAATGGTGCGCGTGCCCGGATTCGA
ACCAGGGATTTCACCGTGAGTCCCTCCAAGAGTATGCGCAAGCCGAGTTTGGACAAGGGAATGAAGCGTCTACAGAGATCGGATCGGCGTCGACGCCGCT
GAAACATGATCGATCCGCGGATCGGCAGAGCCTAGGGAGGAGCTCTACCGACGGGACAGAGGAAGGCCCGGCAACGGGCCTAGAAGAAAAGCCTCAACCT
CCTCCCCAGGTCCCCTCGGGGACCCCCGCAGGGCACGATGGGAATCGTGGCCTGCCGGACGAAAGTCCACCGGCGCAAGCCGGAACCCAACCACACCGCG
CTAGATCGACCAAGAAGAAGCCAGCAAGATCGAAGTCGTCGCGGAAGAAGATGAAGGCTCCAGACTCCGATACTGACGATCGAGCCGATCTCACACTGAC
CGTGGCTGAGGATCAACTCGCTGTAACGTACTACAAGAAGGAGCTGCACGCTTTCCTGCTTCAGGACGATGTGATGAAGCTCCTCCGGCCAAAGCTCCTC
GGCGATCTTGCGGGACCGGTGTCACAGCCGACCCCTGGATCGGACAAGTTGGATGCCGTTCAGACGCTGCTACGGCTCTTCAAGGAAGTTGGTATCATCG
CAGGAGTGCTGGATGCGGAAAGCCTGTTCGATCTGAAGCTCAGCACGATCCGAACTCGGCCCAAAGGCTGTTCCTGCTACTGAAGCCGTTAGTCGGTGAG
TCGAGTCGATCCTTGACAGAAACATCAAGATCGCCCCAGACGCTATCGAGATCGACACCCGCCAGATCGACACCTGCGCCCAACCCGGGTGGCCAAACTC
CGACGTCATCTCCGTACGTGCCTGCAACGGAAGACGTGGAATCTGACAGTGTCGATGACCCGCCACCGCGCATGACGCTAGGCCCTTCCGGTGTCGCTAT
GTTAAGAAGTCGAGCTGAACGTGCTGAGCGTGAGGTGGTTGTGCCAACGCGAGAGCCGAAGGGCGTAGCAACTTCAGTGCGACACTCCCCGGAAAGACTC
GAGTCGTTCTTCCAAGCAGCCATGGAACGTTTTTTGAAGGAGCAGCAGCTACTTGGTGTCGCGCTGAAGTCGCGACGACCGAAGATCAAGATGTGGAGAT
GGAGTCGGTTGGATGACCAAACCGACACTCTGCGTCAGGGGAGTTTGATCCTGACGACCTCGATCTCAGTTGGCCTATCCGCGCGGCGGTAGCAACAACG
GCTACTGCTTCGCCTGGAGGAACTGGGACCGCACCACGCATTCGTGTGTGTGCAATGTCGGAACTGAAGGAGTTTTCCGGAAAGGACGGCGACGAAGATC
GAGCTCGATCTTGGGTCAGCAAGGTAAGATCGGCTTTCGTCTGCGATTAAGCGCCTGATGATGAGAAGTGTCTGGCGTTTGGTGATTTGCTCACTGGTCC
AGCGCGAAACTGGTATAGGCAGCTGAGCCGAACAACTCGCACCACGTGGAAAGACCTGCTCCAGAGTTTCCAGGTCCAGTATTGTGGGCGTGGTGTCTCG
GTTGCCCGCCAGTACTACCATGCTCGGAAACGATCTGACGAGTCGCCTCTGGAGTACCTCCACAGGCTCAGCGTCGCAGGCCTGCGGACACGTCTACAAG
TCAAGGACGGACCGCCAGACGTGCGCCGGGAACATGTGGAACACTTTATCGAGACTTTGGATGACCGCGATCTAGCGGACCAGCTTGCCCTGCTTCGGAT
TCCCGACGCGGACACTCTGGAAGAAGTTTTGCGATCTCGCCAGCGTGCCTAAGCGCGACAGAGCAAGACGGTGTACGGCTCGATTAAGCCCCGCGCGAAG
CCGCAAGCCGCCGCCGGTGCTCGCGCGGTACGAGCGATTCATGTGCAGAGCGACAGCAGTGACTTGGATGCAGGATCCAGCGACTCGGATGAAGAGGGAG
ATCTGCGCCGAGTGTACGCGACTTCAGCCAGTAACGATCATGGAACGACTGAACATCGCTCGGCCGGCCGAGATCGGCGTCCACCGGATCAAGATCGAGA
CCGTCAAGATCGTCGACCGGGACATCTCTCTAAATCGATCGACATGGGGCCGCCCCTCAAGCGGTGCACTCATTGCGGGTCTACCAAACACGACGATCTG
GGATGCTGGAAGCGGCTGACGTGTGAAAAATGTGGCAAGCATGGTCACCCGTCAGATCGCTGTCTCTTTGTCTGCAAGGCCTACGGCGAAATCCACGACG
AAGGAAGCTGTCCGATGGAGGAATTTTACAATTTGATCCGCCAGTGGTACAATCCCACCAAGCACGGGGGCATGCTGCCCGAGTCCGCGGAGAAGATGTT
AAACTAGGACGCTCGCCGGGTTGGAATCCGGTACGAGACGAGCGTTCTCAGTTCTGCATCTTTGCGTATGTCGAGAAGCAGTTGCAGTCGACTGTAAGCA
AACTCATCGACAATACATGTGATCGTCAAAAGAAACCTACGGCTGCCATGTCAAGTCTTCACCAAGTTGATGACTACTCAAGATCGAGCGTGAAGATGGC
TTTGGATATCGCGTTGGGGGAGTCGCGTGGTTACTGGAAATACCATGTGCCTGACAAGAAGTTCAAGCAAGCGAAAGCTATGGGCAAGATCAACAACGAA
AAAGCTACTCTGTTGTTTGACAGTGGTGCCGAAGTGTCTATCCTAGACACCGCCTTTGCTCGTAAGGTGGGGTGCTACATTGACGAAAGTCAGACATTGG
AGTGCGAAGGCGTCGGAAAATCTCCATACATGGCGGAAGGACGTGCACGGGCCAAGATCACGCTCGCTGGATCACTTGTGTATTTTTTCGATGTTTGGGT
GGGTCCGCCGACCGGCGGTCAGGACTTAATCATCGGCATGGACTTCATGGTACCGGCGGGTATCCGCCTCGCTCTTGCCGACGGGACAATCTGCCTGCCA
GACGAAGTGCGGATCCAGCTCGCTGGGAGACGTCCGCTCTACGGAGACAAGGTGGAGCAGGTGACCTTGACCGGTTACCGCGAGATCGACATAGCGGGAT
CCGTTGAGGTGAAGCTGCGCACAAGATCAACAGAGCATCAGAAACTCTGGGTTACGCGCGGCGATCGGTGGGTGCCTACCGTGACTGGTGGACCGGACAA
GATCCGCTACTTGCAACTGACAAACGTGAGCGATCGCGAGTTAGTGCTGCATCAGGGTACGCGACTCGCGATGTGGCTGGCCGGAGATCGAGTGCCGCGC
TCACCTGGGTATGTCTCCGTTGGATCTCGCAGGTACGCGGAGTGGCAGAACTTGGCGTACCAAGCAACCACCGA