Description :
From Genome Similarity Track
Location :
Scaffold_410:10586- 16115
Transcript NameFunction/comments
Phypl_g7999hypothetical protein PHYSODRAFT_262310
Phypl_g8000hypothetical protein PHYSODRAFT_315046
Phypl_g8001conserved hypothetical protein
Phypl_g8002hypothetical protein PHYSODRAFT_513613

Sequence
5529 bases(100 bases per row)
CTTAGCGAACCCTGAGAACAGTCAAAACTTGAGTTTAGTTAGAGATTTACGATTGCGGGCTCTCAAAAATAAAAGCTTTCGTGAAGCGAAATACATGTAA
ACAGTAACAGATCTGCTATCGTGCAAGAGTTGCGATGCCACGAAGCAGCTCTCCAAAAGCAATCCCCAACATGGTGGATTTGCTGTTTGCCAGTTCAAGT
TGAACTGTAGGCGCCAATGAAACCCGTTGAACTTCAACGGGTTTCATTGGGGTAGGGACCCTACCACTGGTATTATATTAGGCACTCGTTATTTAGCCCG
AATGGGTCCCATAAAAGCTCTATTTTATACGTATAGTCCGAGTNTTTTATGCATCGTTATCGTATACGCATGTATAGCTGGTAAGCCATTCGGGCATAAT
ATAAGCTACCAGCGTGCCCACGCGAAAGTTGTGTTGTCGAACAGTTAGGAAAACATGTACAAGTGCGGAAGTGAAGACGCGCCTTTGAGAGTGGGTGCTT
TGCAATATTACTGTAGTAATATGCAGCAGGTTACCGAGCTTACAAGCGGTTCCCACTTTGAAGAATGAATCAAAGTTTTCGTCCGAATGTTGAAGCAAAT
CTGCaatgtccagcagcatcgggTGTGCTGGAAGGGTGACAACCCACACTCTCAATTGGTGGCGACGCAAGGCTAATAGGCTCCCTGACTTGTCACAAAC
ATGCTATGAGTTAACGATAAACCCAGACCACAAGCGTCAACCGTGCCTGCTATCATGGGAGGGACtacggagctgctcgagctgtaTGGTTCATCTACGA
TTTTAGCCGCTCGCAAAGTTCCATTCCCGATTTTGACCGCACGCACACCGTCCGACTCCAGTAAGCATTCCGCCGTCATTGAAGCTCCTTTCGATGCTCA
TCGGTCTCCCCCTCCTCGTGGCTGGCGTCGTCAACGGGTACGCCAACCCTCAAGCGTGTTCAGGAGTCTGCATCAACGCTCACGACCCGTCCATTATCCG
GCGTGGCGATGGAACGTACTTCCGCTTCTCCACTGGCAACAAGATCGCCATCCATTCTGCTCCTGACCTCACGGGCCCTTGGAAATatctcggcgctgct
gttcctgacGGCTCGACGATCAACCTGAAGGGCAAGGACGATCTCTGGGTACGACTAACACTTTGACTCGAGTTGATTTAGTATGGCACTAACATTCGTG
TACTGCTACTGTAGGCTCCTGAGGTGAACAAGGTTGGAGACACGTACTACCTCTACTACTCGGTCAGCTCTTTCGGAACGCAGAACTCTGCCATTGGTCT
GACGCGGTCCAAGACGATGGAGCCGGGTTCGTGGGTTGACGCAGGCAGCATTGGCGTTACTAGCGACGCGTCCAAGAAGTACAACGCCATCGACCCCAAC
CTCATCCAGGTCGGCAGCCAGTACTACCTCAACGTTGGTAGCTACTGGCAGGGTCTCCACCAGAccaagatggcggcgctgccagAGAAGAGTACGGGTG
AAAGTGCTTACCAAATCGCTTTCACCTCGAATTACGAGGTCGTGGAAGCTGCATTCGAATTTGCCTACAACGGCTACTACTacctcttcttctccaaggG
GTCTTGCTGTGGCTACGACAAGACCCGACCGGCGAAGGGCAAGGAGTACCGTATTCTCGCGTGCCGATCCAAGAGCGCAACCGGAGGCTTCGTCGACAAG
AATGGAGTCGACTGCCGTAACAACGGCGGCACCGTTGTCCTGGAGTCTCACGACTGGGTGTACGGCCCGGGAGGTCAAGGCGTCTACAACGATCCCAAGT
ACGGCCCCGTGCTGTACTACCACTACGGTGAGTTACTGTTATTGTGCCTAATTATTGTACCTGCTAGACGTGTTCTAACATTTTGATGGCGAAACTTGAC
GTGTAGTGGACACTCGTATCGGCTACGCCGACGGCGACAAGCACTTCGGCTGGGACAAACTCGACTTCTCGAGCGGCTGGCCTACTGTGTAAACACCCAA
GAGCTCAGGCACAATATGTGCCCGATGAGGCTTGCCGAAGAACGTTCAACGTTTTTAATGTTTGAGTTGATTCAAGATAACTGCAAGCAAAGACTGCCCA
GTTACTCTCAAATCGAACTATGGTGGTTACACcaccgcttcttcttccgtcAGGTCGAGCTTCTAACAAGCTCCTAGgttctcgtcgtcaccgaTGGCTC
GAGGATAAGTACCCCCCATCATATAAAGAAGCGAATTCTACGCGCTTGGGGCGAATTTGATACTTGCCCGGGAATGGAGAAAAGGGTGTCAACTGCATCT
GTTGTGTTACGAGAGTCGAGGAAGGTCTACTCCAAAAGCGAAAGCGACACCAGGTGactcagcagcttgatccGACAGTAGTTCCACGTGTCCTAGATGT
TTCATTAACCGTAGGCCACAGCATTTTGCGGGGCGTGCTATCGGATTCGCACAAGAAGGAGTTGCACTTGGCGCGAAGATCATTCATACGCTTCTTATCC
CGTTGACATCGATGCTCGCGATGACAGTACGATTAAAAagaagcccccccccccctccccgAGACAATAGCCTATTGCCACAGCTTGTGTTCCTGAAATT
GATGTTTCGCGAAGCGAAATTGCGCATTTTTCGGCGAACATCACCGCCACAGCGAACGAGCTGAGAGGTGTGCGGTCATTGTCTTTGGAATCGCGAATGT
ACTAGTTGCCATCGGGTACGAGAAGCGTGTCACCAGTCGCGAAAATGAGTTCTGCGAGATATTCAACTCGGTACACTGCAACTTACGCAGACATGAGTGT
GTCTGCAAGAAGAAAACTTCGACAAACTGTTGATCATGCTGGGCCTGCTCTACCAATATTGGCGCACCGAGCTCGGATTCAGCTGCAGACTAATGAAACT
ACTGTCCGAAGATATCCCGTTAATTGATCCGAAGTTTCTCAACCTAGCGACTGTATCCGGATACAGCCGAGCACATTACGTTTCTTTCTCGAGTGGAACT
AAATGCCATTTTGAAATGTGTTGTCGAAGCCAGCACCAAGAACAATGTGGAACACCGCGAGAACAACCCTGGGCTCTTGCAGTCAATGCTGTACTAATCT
TTGGTCGGCAGAAACACACGACCAAGCTGAGCAGACCGGTATACGACCCAGGGGGAAATCTGGCCAAGTTTCTGCATGAACGCAGTGACCACATAGCGAT
AGGTCTAACTATATTCCTGCGATATTGGCTGTTCGAGGTCGTAGCTCTTCTCGATATCGCGGACGCTCCTTTTCCTTAGCGCTCATTGGCATAACTCTGC
CGAGGATAGCTTGGTCGCAGCTATATGGACGCCGAGATACAGTCGTTGAGAGGTTTAAACGGAGGAGGTGGCTGGTAGCAGTACGCAGCATCGCCATCTG
AGGCACCGCTCCCATACCCATGGTCGCGTTAAGCAGCAACCCCCATCGTGAGACACCCAGCTTCTTCCACAGCGACGAGTTGTCGGCAGCTCGATGCCAC
CGGTACGAAACCTGGGACGCATACCCTAGGCTCTTCAAGTCCAAGAATGACAGCACTCGCTCACGTAGCTGCTGTGCTAAAATGTGTTCGCCGACCTCGA
GGTTTTCCCCACGTTGAGTTTCTGCAGCCGATGCGCGGTGCAGATCTTCGTTCCCGGCGGCAAATTCTGCCAGAGTCTTTGCATCACGAGCTTCGTCCTC
CGCCACGTCGCCGTAACAATTCTTCACTGCAAGCTCACACTCTCTTCGAACTAGCAGCCGAACGGTGCGATACTGGCCTTTGCGCGCAGCGTAAAACAGT
GGCGTTTCGTCATCACTCGTCCGCGCGTTGATGTCCGCGCCGCGATCCAGCAAGAACTCGGCGACAGGAACATGGCCATCAAAGCACGCGAGATGCAGCG
GGGTCTCGCGGGCGTCGTTGCGTACATCAACGCCCCATCcgaagtcgagcagcagctgcagcacgtccaaATGGCcccgagctgcagcatggtGCACCGG
AGAGCACCCGAGCTGTAAAGTAACAGTGAAAAGCTACGTTAAATCTGCGTCGCCACCTCGTAATTCAtagctccaccacgtacgAGGCCTCGGCATCGGT
CCTTGTCGACTCcttggtgcagcagcaggaagacggCTCGCTGCTTGCCCTTCTCGCTCGCGATCAGCAGCTGTTCATTGAGCTGGTCGCTCTCGATCCG
CAACAAGCTCGTCaactgctgcgtcgcgtcGTCCTTCGGTCGGCTCTTGGCCTttatcttcttcttcttcttcttcttcttcttgctgagcTCCGGCTCC
TCCTGAACCTTCACGTTCCTACACGGCGTCTTCCGCCCagccgacgtcgacggccgCAGCTCATGGCCATCTCCATCGACCGCCATGTCGCCcctggcag
cagcgatagAACGAGCCAACAAGGCAGGACACGCAGCTATCTATGGCCCGCAGCAAAtaactgcaactgcaactgcgATTTACACTTgtcagagtgatgg
tcattTTAATCGGTTACCACCGTCATGTGTTCGTGCGACATCCCACTATAAGAATGTCGCGCGTATGTTGCACGAACGTAGCCTGGGAGTGTGCGGCTCT
GAATCGACTCAACGGACCCGCTACGCGCTAAGGCAGCAGACGACTCGAGGCCGGCGACGATGGTGAAGCCCGTGGTGAACGCCAACATGAACAAGACCCT
CCGCGAGGTGGTGGGGCGCTTCGtggccgcgccgccgcagctctcGCACAAGCAGAAGGTGCAGCGCCTGTACAAGCAgtcgctcaagacgctggactCG
TGGATCATCGACCGCCGCCTCTGGAACGAGGAGGCCACCAAGATCCGCGCCGAGTTCAACGCCAACAGCCAGCTGGACCCCGAGTCTGGGTGCGTCGCCG
TGTCAATCTGCTGGCAGTTCTTGACGCTTCCTTTGCTCTTGAAGTAATTCCGGTGGTCTGTTGACTGttgtttgttgttgttgcccaGTCTGGCCAAACG
CCTGGTGCGCGAGGcgcaggagaaggtggaccACTACACGCACCCGGACCGCTATATATTCAACTACATGCCCGGCGGCAGTCTCTTCATGCGTAACGCG
CCCATCCCGCTGGACGTGTGCTTCCCGGACGGAGAGATccccgaggacgtggagctgtcgccgctcGAGGGCATCAACATCGACATGACGCCGCTTCCCG
CCAAGGAGACGGTCTTCGTCGACTTCTCCAAGAAGGGCTACGACTAAGCACTATTGACAGCAGGTGGCtccgacgagatcgacgctTCTGGCAGTGGATT
GAGAAGGAGAGAGAGTGGGTTCCCACCCCATTGCTGGCAGCAACGTGATCGAAGCAATTGAACAATTCAAGGAAGAACGGGTAAAAGTGTCGTGTTTTGT
GGGGGTTGCGGTGGTCTTTGCTTGCGTGTTGGATGCTAGCACAGGGAAGAATGGATTCACGCTCAGGAGTagttgagctcgtcgcagATGCGGGACTTGG
TCACAGCGGTGTTCAGGCCGAAGTCGCGG