Description :
From Genome Similarity Track
Location :
scaffold_16:105851- 116813
Transcript NameFunction/comments
g964.t1 vesicle coat complex COPII subunit SEC13
g965.t1 hypothetical protein PHYSODRAFT_309136
g966.t1 hypothetical protein PHYSODRAFT_353495
g967.t1hypothetical protein

Sequence
10962 bases(100 bases per row)
AATAAAGCGGAGTGGCGACAACGAATGAACACATGCACAATCGAGTCCCTACTATTTTGGAGATCACCGATTCCCGAGCCACGGGAGTCCTCTGTTAGTC
ACATCTAGTTGCTCGTGATTAAAGCTGCGCCTTGATCAGTCACTGAAGACATTTGCGTCCACTCGTGATTGCTATGCTGCTTCCAGAAGGTAACTTCGTC
ATCACCAGCGGCGACGCTAAGCACGGAGCCCGTTAGCGACCAGCTTATCCGGTATATGGCCGCTCGGAACGTATGAAGCACAGTGGACACCCACTCCCCA
TCAGCCTCATCTTGAGTCCAAACACGCACGGTGTGGTCATCCGATCCGGACGCGATTACATTCGCTGGGATACCAACATTCGGGGCCCAAGCCACATCGC
GAACCCAGTCGTTGTGCCCATACAAAGGGGTATTCACAACTTCCCAGTAGCTGTTGCCAGGGTTCCCTCCTTCTTGGGGTGCAGTGACAAACTGCCAGAT
AGTGATCGCATGGTTACACGATCCAGTGACCACGCGCTGGATAGGGCCTTGAGCTCCTTGCGAGCCCAATGAGTTGTAAGGAGCCCAGCTCACGGACGTA
CAGCCCATGCCCTCCTCCGAGTTCAGGAAGCTCGACGACACTACCCATCCCTCACGCATACGGGTAAGGAACGACACCTGTCCATCGGCTGATGCACTTG
CCAGGCACAGTCCGTACTCGTACGGCGCCCAGGCCACACTAAGCACTGCCAGCGAGTGGAACTCGTGGACATGTTTGAGTCGCCATTCCGTCACGTTTCC
GACTCCCCCAGCGCCCTGTTGGACCAGTTCTTCTCGATAAATGTACACTTTGCCGTCCTGAGCAGCCAGAGCCAACACGGCGCCAAACTTCGGGTGTGCC
CAAGCCACGCGGTGAATGGGGGCTGCTGAGTCGTCGGCAAGAGGTACCACGTGCTGGAGTACGTGAAGTTGCTGCTCCTGCTGCTCTTCCTGGCCACCCT
TTTCGGCCGGGTTATCACCGTTGTCTCCATTCGTCACTATGGCCTTGGAAACATCGTACACGCGGAATGTTCTGTCGGACGAGCATGTTGCCAAGCGCTT
GCCGTAGTAATCCAGCTGAATGTCGTAGATCATGTCGTTGTGCTCCGTATCGATGCTCGCCGCAGGGGGATGGCGAAGTTGCGCTTGTTGCTGGTGGTGC
GGCTGTCCGTACGGCGCGGCGAACTGCCCGCTAGCCGTCGAGCCGTGCATGCCGCCAGCGAACTCCATCTTCGACTCCTAATGCCGATGTGGCCGGATAC
GAAATTGTGCGATGGACTATTTCACAATTGAGACCAAATATGGAGACTCACAAAATGGACCAAATTTGATTTGGCGAAAGGCAACTTTTACCGTGTTATG
TTTGCTGTCAATGGACCGAGCGGGCCGACGTCGCGTAATGAGCGGCGCGTGAAGAGCGACCGGCAGCGAGAGGAAGAGGACGAGACCAGGAGGCAATGGG
CTGAGAAGAAGCGAGAGCAGTTCTTTCTGGAGAAACGTGCACAAGGTGGCAACGGGAATAGAGGTCAGTTCTGAAGTTTGTATGATCAACTGCAACAACA
TCATTCATTTGCCATGCAATTGCAATAGACAAAGAGAAAGCAAAGCAGTCTGCTGTGCAGTCAAATATTTTCAAGGTTCGCTGTTGCTGAATGGTGCGGC
GCGTGGTATTACTCATGGGTACCAATGCTGGTTCTTGCCATTGCCGTTTGCCTACAGGGCTGTCGGATTGTGTTCAATGGGCGCACGGGCAAAGTGTCTT
CGTAGGTGGTTGCACGCATGTGGTAAAATATGGTGGTTGTGACACCTGCTTGTTGCTCTTTTGCAGATACTACTTAGCTAAACTGGTTCAGGAACACGGT
GGCAATGTGGCGTATGCCGATTTTGACTTTGAATACATGTATTAAAATGTGCAGTGATTAACATTGCTGATGTATGCGGTTGGTTAGCTCAATGCTGACG
TCCGCACGCGTCACGCACATGGTTGGCTCCAACTTGAACGGGTCCAAGGCAGACAAAGTGCTCAAGGTATGTTGTTTATACTGGACCAGTACTACTGGCT
GATATCAAGTTGATAATGACGTTCTTGCATGAATTACCTAGAGCTGTGGCAAGGTAAAATTCGTGAGTCCAGGTAACATTTACACCCAACCTGCCATGTA
CGTGCCAATGTAGAAGCTCACTGAAGCGCTGCGTGGGTGTCGTGCAGAATGGATATTGCAATCAGTCAAGCGCAACAAGCGGCAACCTGAGTTTGAGTTC
CTCGTTTACAAAGACTACAACGCAGGCTCACTTAAAGCTACTTTTTCCCGAGCAGCTCCAGCAGCCAAGTAAATGCTTTCATCCTACTGCTTGTACCAGC
ATGGAAAAGGAAAAGCGCAACACAAACCCAACTTGTAAAAAGAGAAAGAATATACGATGTATAAGGTCACAACTAACCAGAGTAGCATTCGTTGTCGCTC
CTTCCAAGCCAAAAACGAGAAGGCGAGACCTAGGAGAGGAGCCCAGAAGAGACCTAAATAACCGCAACCTGATACTCCTTTCCAAACGCCATCGGAATCC
TCGAACAGCCTTTTCACCCGCGCCGCACACAAGCCCTTGATTTTATCCTGTCTGGACCTCCGTGCCGCGCCTCTTATGCCTCTGCACAAGATTCCGGAAC
TAAACTGCAGACAAATCAACTGGCGCGCGACGCGGGGCGAACAGGACAAAACGACGCTGCTTAGCAGCACTTAGACCCGCCGTTGGACGGAACCTGCTGG
CCGGGCGTGAGCTTGACACCAGCCTTGGGGGCCACAGGTGCGTTGGCCATGCGCTTCTTGATCTGGGCGGCCATCATCATGAAGGCCTTCTCGACGTTGG
CGGCGTTCTTCGCACTAGTCTCCAGGAACTCAATGCCCAGACTCTCCGCAAACTCCTTGGCAGCGTCCGTGCTTACCACGCGCTTGGCCGTCAGATCACT
CTTGTTACCGACCAGCAGCTTGTTCACGTTCTCGCAGGCGTATCTGAAAATAACAGTGGCGCAACGGTTAGCTCGTTACCGTGGCACCCAATGCAACAGA
AATCCTGAAGTACTGTATCACGAACCTATCGATCTCATGCAGCCACTGCTTGACGTTGTTGAATGACTCCTGGTCCGTCACATCGTACACCACGATAATG
CCGTGAGCACCGCGGTAGTAGCTGCTAGTAATCGTGCGGAAACGCTCTTGGCCAGCCGTGTCCCACTACACAAGCACAAGTGAATTGGCACAACCATTAG
TCCAGCACTCTTACTAAGTTGGATAACAAGTCTTAAACTTTAGTTGCTTACAATCTGCAGCTTGATGGTCTTGCCGTCCAACTCGATCGTACGGATTTTC
TAGGCGCATTCACAAATACCACCACGTCAGCGATCCTGATATAAATTGTACCTCACTGGACCTCTGCTATCAAACAGAGCCTGGCACTCACAAAGTCCAC
ACCGATGGTCGAGATGTAGCTCTCCGTGTACGTGTCGTCGGCGAAACGAAGCAGCAAACACGACTTGCCGACACCAGAGTCACCGATCAGCAGCAGCTTG
AACAGGTAGTCACTGCACACAAGAAGAACGCATCAGTACGGCGTAGTCGTCACTTATTATCAATAAATCAGTTGCGACTTAGAACGTACTATTCCGGGTT
CATCTTGTGCGAATGTGGAGAGAAAGCGACAGGTGAAGGTGCTTAATCTGAAGGACGAAAGCAATTCTGTCAGATCACAGTATCAACGGCGGCTTATGGG
GCCACACTCCTTCCTTTCTCCCCCTTCCGCGGCTTCTGGATTCCGAAGAAAGATCGAGGATCCACTCACTTCTACCAGCTGGTGAGCCAGGGGAGAGTGA
ATAGGAAACAGGGGGGGTACAGAGGGAGTGTGGGGCGCCGCAATTGGCGCTGGGTGTGTCCTAGAGTCACCTACACGAAGAGGAAGAAGGAAGCGACTCG
CGCGTTCCAAGCGTCTTGGGTTGTGTGGGCGAATCGCAGATTGGTTTCCCGTCCGATCGAGAGAAAGACTGCGCCGTTTTCCCTCGCCGAGGTTTTATTC
GCAGAAATCGAGGTTTTACTTTCATTTCATCCAATGGAAACGTTCCTCAAAGATTTCAGCCAATCAGATCGACCAGCGTGGCGGGGAGAAAGTCGTGTGG
ACAACACTATCACCATGCAAGTCAAGCCATGTCGCTACATGTACGAAGCCATGCCAACGACGACGTTGAAGGCGTCCTGATCTTTGGTCCTTATGCCTTT
GGGCTCACCGTGGATGACAACGGGAGGTGCCTGCAGCAACAACTGACCAAGGCTGGATGAAGACTTGTCAGTGTGGCCAATCGCGCTGCTTGTGTCCGTT
GCGTCAAAGCGCAAGATCGCTTTAGCTAAATATACACTTCTGGCGACGAATGCAACTCAAACTCCATGTGTACTGGTAACGGCGGCGGCCACTATCCGTG
CAGCATACGAGCGCTCGGTCGCAGCAATTTGCTATCGATGTGCCAATTCTGCTGCATCAATACGACGCAGCCATGCGATATGTCGGCGGATCGCTGTGCG
CGAGGGCCATAAAGAGCCATTTCGATGGGCTCATTAGACGTAGCTTGGTAGTCACCTTCGAGCTATACACGTACTCCTGGATCTGTAACAAGTTCCTAGC
ATTCTTCCCAGCGGCGCCATCACCCACTCCATCTTATATCAAGATTTTTGTTGGTTTCGATGCTAGCCTTGTTGCAGAGAACGCTGCTGCCGTTAACGTA
CATATCCAAACCTAATAGGTTACAGACCACAATGCATCATGGCATGATTCATACATGTACTTACCTGTCTTCGCCGATACCAACACGATTTGGCAGCTCG
AAATACGCATCGCAGATTCTTCTGATTCATTTCTTCAACAAGAGTGTTGGTCGCTCGTCCTCCTTTTACGAACGAATTACAAACCATTCTCGAAGCTCTA
TCCATACAAACACCAGTACTTTTCTATTTTAAGGACGAATTACACCCTAATTCCTAGTAAATATGGTTCCTACCCGTAGGGCTGGGTGTTTGGATTGTTC
CGCCTTCAGACCCCCCACTTACACAAAGAAAGTAAGCCGAGAAGAAACGTCGAAGGCAAGTAACAGATCAAGGCCCGGCCGGCAGCGGCTTCCGCCACGC
TGTGCCGCGGTCTCACTCTACATGCGTACGTGCGCTTTCATGTGGCGGTTGTACATCGGCAGCTCGCGTCGTTCAAGTCGGTCTGCGAAACGCGTGAACG
GTAGTGAAGCGAATTCAACCCCACATGGAAGCAGACGTGCATTGCCTGTGGATTGTGATGTTTATTGAGGGTCGCAGGGCGGCAATTTGGAGTGCTAATA
GTGCGCTGCGACCCTTCGTGACGAGGTACCGAGTCTGAAGCGGGAAAGAAGCTGACTGGCGGTGCTTGTGTTTGCTGTTTTGACTTTGCTGTAGGCGTAA
CTTATCTCGGAGAAGCGCAAGCGAGAGGATAGTCACGCCGCCAGTCTTTTTCGTAGCAACGATGAGTTCATTCAAGAAGGAACACGCGTTTGGTACGTGC
TGCTTTACGGTCTCTGATATAGACTGTGTGGGAAACGCTAACGACGCTTGACGGTGCTCGTTGCTTGCAGAGAAGCGCCAGGCCGAGGCTCAGCGCATCC
GATCCAAGTACCCTGACCGAATTCCGGTGCGTGCGCCCAGTGTGTTATATTCGTTAGATTTTTACTGACAATATTGTTTTGTGGTCGTGGGTGAAGGTGA
TTTGTGAGAAGGCGGATCGCAGTGACATTCCAGACATCGACAAGAAGAAGTATCTGGTGCCGGCCGACCTGACAGTCGGTCAGTTCGTGTACGTGATCCG
AAAGCGCATCAAACTGAGCCCCGAGAAGGCAATCTTCATTTTCATCAACAATGTCCTCCCACCCACCGGTACGGCTTCAATGTACTGCAACAAGTATCGT
GTATTTATTTGACGTTGCTTCTTTTTCGTTTTTTCAGCTGCGTTGATGTCAAACATTTACGAAGAACAGAAGGACGTGGATGGGTTTCTCTACATCACTT
ACAGCGGCGAGAACACCTTCGGGCAATAGTTGCACGTGGTGTTGCGCGCGGGGACTGGATTTTGGTTGAAGATTTTTTTTCGTCGTCGCTGTAGTGGTGG
ATTGGGAGCTCCTTTGGGAGCGGTGGCTGGTTGTCAGCTCAGATTTTCAGGCTCCGTCTTAAGAAAGAAATGTTAACAAGATGGAGTCGGGAATGCTGTC
AGGCAGCCACAGACGACAAGGAGTACTTGCTGCTACGTGGTCCATTCTTCTAAAAACTGGCGATGTGGATATTTCCTAGTAACGAAACCCCAGAAAAATA
CATGCAATTCTATTCACTCGCTTATGGCTGCCGTGAGTTGTTGTTCTAGCGTGTCACTTATTCGCGTTGGAACTCCATCATCTGCAGGCCTTGGCCAACG
ACAACAACTTCATCAGCTGTTCCAGTTTCGTTTTGCCGAATCGCGAGATCAGCTATATCAGCGCATTCCGAAAAAGCAGCCCCTTGCCACTCAAGCTCGG
TGACATTCTCGTTGTGGTGAATCCCCCACTTACTCACTCGCTGGTCGTATCCGGCGGCAAAAATTGTTTTGGCATCCACACAAGCAACGGTTTTGATAGC
AGAGCCGCTGGCATTCACCGTCCGAGCTTCCGAAATCATTTGGCATGATGGGAAGCGTAGCTCACGCATACTCAAATTCTGGTCATCTCCACCACTGACA
AGCCTCACGTCAAGACTTCCCGCTTCCTTGCTTCGTTGGCAAGACACAAGCTCGATGCAGTTCACTCCCATATCGTGCGCCAAATAGTTGCCACTTGGTT
GCAACTCACCAATCAAACCTTGAATATTTTCCTTAAACTGCCCCATATTTTCATCGGATAGAACAAGCGAAGCGATCTCCTTCAGCAGCACGCTAAAGTC
CCATAGCGTCACTAAACCATCAGTAGAGCCAACAGCCAACCCAGCAGCCACCGAGTCATCACTAATTTGAAAGCCCACGCAGGACAAAATGGGCTTTCTT
GAGGCTGAACGGCAGTCACCAAGTTCAAGAAGGTTGCCATGGTTTGCGTCTAGCAGCAATAGCTGGGTAGATCCCTCCGAATTGCAGGCTGCCACAAGTC
GATACGCGTCTGGCACAGAGGGAATCTCAAACGTAGCAAGTCCGAGAATGCGGTGGTCCTGAGCTGCTTCGGCACGTTCCTGGCCGCAAACATGGCGGAG
CAGGTCACTTTCCCCGCGAACCATCCACACATTCAGACGCTGCTTTCCACCTCCTGAGAGAATAATGTGTTCGATTTCATCGGGGGTTTTGCGCTGGAAC
GTTGTAAGTGCACGAACGGTAGTTGTATGGGCAATCCCTGTTGCCACACTACCCCAACGCAAGCTTGTACGATTCTCCAGGTTTGTGAGGTCACGGCGAT
GCAGCATGAGGCTGTTATCCTCTGCTGCGGTAACCAGCCGCTCACTTCCAAGGAATGCCACACAAGTTGTCATGCGTCCGTGATGGTGGTCATGCAGTGA
GCATCTCGAAAAACGTGGTGAAGTGTCGGCAGCATCGCACGGACTCAGAAGAGTCGAGTGCACCTTGATGTCAACCTGTTCCTTTTGAGTCGCTGGGGGC
GTGAACACAAACGTGTGTGCGGGCAAGGCAGAGTCGAAGTCTCTCGCTGTCGTAAAAAGCGCATGAGGGCGGCGCCAACCACCACATTCCACGTTAAATA
AACGATATTGCGCAGAGAAGTTGTGAAGAACAGCCTGTGCCGCGTGGAATCCAAAGACCATAAGATCGGCCTTGGCCTTAGATGTGCTCCACCAAAGCTG
CTTGACCGTGGAAATCCCTCGAATGGACTCACGACCGACCTGTACCGCTGTCAATGCTCCATCTGAATCTTCTTCCAGCGCATACGAGCAAATGTACCCG
TCATGTCCTCCCGACAGCATGACAGAGTGCTGCTTCTCAGCATCTTGACTTTCTTGGGAAAGCAAAAGAGATGCCACTAATTCACGCCCATGGGCACTTT
TCAGCACGAGAGCTGGGGCTTGCACTGCCTTGGATCGGTCATTATGTTCCGGCAAGCTGAGCGAGCGGTGAAATATATACACACTGCCATGTCCGTCGCC
CGCAACAATATTTCTGGTTATATCCAAGCGGTCCACCACCAAAACTGAAGATACTGAGCTCTTGGCAGGAATCTTAAATGTTACCACAAGCTCCATCGTG
ATCGACGGGGATGCCAAGTCTTCATTGGACTCTAGAATAGATGGCTTCCATTCAGAGAGGATGCCGCTGGCACTGCTGACGAATAGAGAGCCTTCTTGAT
CCCACCAAATCTTCATAACTCGCACATTGCTTTGAGTAATCCATGAGTATAGCAAACAGCCCGTGGATGCCTCAACAATGCACACGCGACCTGTTACCTC
GCCCAGCAGCAAGAAGTGCCCCGAATAATCCATTGCAAACGTCGACAATCCACTCCGTGTTTGAACGCCAACATCATCAGTTCGAGGAACCGTAAAAAAG
ATCTCGCTGGTGAGTGAAGACAAGTCCAAACGGAAAATATCACCGTGCTCGGAGGCAACAAAGGCTGCCTTGCCGTTGTTCTGGGTACTGAAAACGATGT
TGCGCACGCTGTGCGAAGACAGTGCGCCCTTCTTCCTTTTTGGTGTAGCTGACGTTGCCGTAATAGGAACACGAATCGTCTTACACACCACACTATCCCC
AGAAGCAATAAACGAAGACATGAGCTGCTGTGTGACGTCCCAGAGCTTTACGGCGCCGTCACCACCTCCCGAGGCAATCATCTTTAGTGACGGGTGGACC
GCTGCGCGCCATACGTGCCTGCCAACATGTCCTTGCAGTGTGGAGACGCAGTTACCATCAAGACCCCATAGCTTGCAAAGACCATCCTCGCTCGCGGTCA
CCACACCGCGTTCCCAAAACGCTACATCCCAAATGCGCGCCGTGTGGCCCCAAGACCGGAACACTGGAGAGTATTCACTCGCAAGTAAATCAGCGCGTGT
CGATGATCTTGGTAAATGAAGCTGCTCAGCTGTGATTGTTCCCTTGTTCGACCACAATTGCACCGTTCGATCGTCAGAGACAGAAGCCAGCGAGCGGGCA
TCTGATGACCACGCCAGCTTAAAGAGTACGCCATCGTGGGCATGCAGCCTTTGTGTAGGCTCAACAGCAGAGTCAGTCTCTTCACTCCCGTCCTCCATTG
GGTTCCAAAGCAAAATCTGCTGAAACACCGTTCCTGAAGCAACCACAAGGTCGTCTAGCGATCGGCCGTGAAATGCCAACGCGTACAAGATGCAGCGCGC
GGAACACTGCACACTGCGTAGAATATCGTTGCGTACTGGGTCCCATATTTGCACAAAATTGTGCGCCAGTCCAACTGCAACAAGGAGATTCTTGTCCTCG
TTCCCAGATGCAACGTCGCTCGTCAGGAGCTGCACGTCGAACACCCAGTCGCAAAACACTTTCGGTTTGCCCAGTACTGAGAGTTCCTCAAGCCCGCGAG
CCACCTTAGGCGTCTGGGGGAGGTCCTTGAAACACGACACCCGCTTCTGTCCGAAGAATGCGCCTACAAATGCTTCCGGTGTAGAGTCTGGAAGTCGGAC
GATGTCACAGCCATGCAGAATTCCTCGCGTCAGCACGTCGTGCTGTCCCAGAAGCTCGCCAGTTGCAGTAGCGTACAGGAACACACTTGGGCCTACACCC
ACGTAGAGTAGCGATCCATCCGACGAGAACGACACAAGCGTCACAGCGCCCAGGAACTCCTGCTTTTTGATCGGCGGGTGCACCATGACGTCAAGCTGCG
ATGATGACCATCCGTGGCGTAGGCGTACCGGTATTACCGGTATTTTGCTAGTCGCACGTGAAACGTTTCGCTGTGGCAGTTGGTGTTGCACATGGCTACA
CATTGAAGTGGTTTTATAAGGATGCAGAGTAGATAAATTACTTTGCATTTTAAGCTTCACAGCTGACGTTGCTGCAGCTTGCAAGAGCAATTCTCCAGCC
GTCTTCTAATGGTACGGGTGCGCTGGCAGCCCGCTGTAGATTGCGGCACTTCTGTTGCTGCTGCTTGTACTCGCTGACCTTGGAGTATACAGGCTTCTCC
ATCTGCAGGACCTTCCAGACCGAGCGAGCTTTGCGGAACTCGATCTTGCTCTTGCTCGGATCGGAGACGGGTGAAAAGTTGTCAACTTGCAACGCCTTCT
CTAGAGTCTCCAAGCTAAGGTTATCAGGAAGGACGGCGCCGTGGAGGAAGAAGTCCCGGACGACTGGGAAGATGGTTTTGGCGCAGGCAATGCACTTAGG
AACCGCAGAAAAGGTGTGAGATGCCAATATCTGTACGAACTGGTGGAGTCCAACACGACGCTGGTTGATAACGTCAGGAGACCGCGAGTTCAAGAGGTGG
CGTCTCGGAAACCAGTAACTGCGTAGGGTTTGAGTGAACCACGCGCAGCCAAAGCACTGCGGGCGAGCACCACCTCCACGACGCAAGAAGAAGGAGTGCA
ACACCAGCATCAATTTCCGGAACTCGGAGTATCTGCGCTCCACTGACCACTTGTGATCCGTCTTGGCAAGCGAGCACTGCAGCACGTATTGCGTAGCAGT
ACTCGTGCGAATGCTCCGCTTCACATTCACCAACTTCGCCACAAGCTTTGGGTCGAGGCTGTTGGGTCCGCACGCGATATTGGAGTGGAAGCAGTCATCG
TCGAGGTACATCGTGTTCGCTGCCGAGGACCTTGACTACGTATGACTAAGCAAAATGCAAAGTGAAGACTGATCCTCTGTCACACCGCAAACTTCCTGGT
GCTAATTGTAGCCACCACCTTCACCTTCTGATCTGCATATCCATGGAGCTGCCTGTTCCTAG