Description :
From Genome Similarity Track
Location :
Scaffold_84:105836- 113861
Sequence
8025 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAACTAAAGAGGGGACCTGGGAACTGCCGTTCACAGAGAGTTT
GTATACTCTCGGAAGATTACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCATTTTACGCCACCGCCGGTAGACTA
CCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGG
GTGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGC
GGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATATGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCT
TCACGTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGC
TAAGCGTTGGGTGTACACACGGGAAGCAACATCTCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCTGCGTTCCTCCCGGCGAAC
TACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAG
TGGGACACCCACTCAGCGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGCTCCGGGTGCAGTCAAGCAC
TCTTGAAGAGGCGATCCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTTCATGTCGACTCCC
GGCCGAGCAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCACTGCTTCGGCTGCGGGAAGATGAGCCACTTCAAGC
GCGACTGTCCCGCGGAAAGCCTCCGCAGACGGTCTTTCCCCAAGACCGTCCTCAAGGGTCGCTGGCAAAAGCCAGGATCCCGGGGACAGGGGAACGCTGG
AAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGAATGCGCGGGTGGCGCGTACCATGGACACTTAGCCCCTGAGAGTCTTC
GCACTCTCGAATCAGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGTCGTGTACGGGGATACGATCATCTCTTTAGAATCTTGATCGATTCTGGGGC
GTCGAAGAATTTTGCACGCCGCCAGACGGTTGCTCGTAATAGCAACAAGCTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGA
CTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATA
TGGATCCAAATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCA
GTCCGACAGAGCATCGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATTCGGCAGATGCTTGGGA
GTCGTCGACGTATATGACGACTCCGAGGATGCTTTGATGGTGGCAGCGCTCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACT
TAGTTCCGCGGACAGCTGCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGCTCCACTCACGGTCGCCCAGACCTTAACTGAAGA
GGAAGACGTCGGATACGCTTCCTGTGTGGGTAGCACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAGCACGCTTCCTGTGTG
GGTACCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGTCGACATCCCTAGACGTGGGCAGCAAAGCCCGACGTCACGGCCGCCGTCGTC
AACGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGCGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGA
GTGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAATCTCGAG
GAAATGACGGCTGAGGCCTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACTCCT
CATCTGTCTTGGACGAGAACGTCCTGGAAGACCTAAACAAGCAGCGTCAGACACGCTTGGGTTCTGAGATCCTTAAGAACCCCAAGGACCCGGTGTATCC
TTTGGTGACGGAGTATGCGGACGTGGTGAACAAACGCCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACA
AAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGATGGCAGGCATGGTGCGGGAGT
CGAAATCCCCGCACTCGACTTCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAACGCAACGGTGCC
GGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATC
CTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGG
CGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAAGGAGG
CAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCG
TCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGAT
CCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGTTTCGCTAAGCCCTTGTCGGGCCTCCTTCA
GAAGGACGTCGACTGGCGCTGAAGGCAGGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAG
ACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCC
AGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGCTCACCTTCT
GGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCGTCCTTGAGAACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTC
TTCGCGGAATATAAATTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCA
TGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCCGGAACGAGCGC
GAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCA
CGGGTGGTCGTACCCAGCGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCACATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTC
TGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCA
CTCTTCGGCTCCACTACAGAGCCTACCCGTACCGGCTGATTGTTGGAAGTCGAAGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAAC
ACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTCCATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCG
ATGGCGTGTTCCGCTATCACGGTCTCCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGG
GAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAAACAGAGCGTGTCAATCGAGTGCTTGAGAACACTCTGCGCAGTGTGTGCGC
GGCAGCTCCGTCGATCACGCACCACGTACGTGATCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTTAACAACGCGGTGCACGCGTCCACGGGGTCCACGC
CGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTTTTCTATTCTAAGTGGGGGAGAGGCTCGAAAAAGCCC
TTTCCTCCCAGGTCTCGGATATGAGACCAGTTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAGGCTGAGTATTGTCAGCAGGGTCCGCGATG
CCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACAC
GAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCG
TACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCAGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGA
CCCCCCTTGACCTAGCTCCTCAAAGCGAGGGCCGGTCGCAGTCGTCGACGAGGACGTCGGAGCAGGCACCCAAGTCTCGGTCGGAACGGCAAGGCTGCGG
TCAAGACCGTACGCCGGAGGGGCTCCATACGAACGAACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGAG
AGTGTGCCGCAGGGGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCATCCAGATCGGACGAAGAGGCCCGGCGATCCAC
CCGCAGGTGCAGGCTCGCGACCTCTCGCTCCGACAGGTCCAGGCGGCCCGCAAGACGAGCGAGATCGCCCTGTTTCCCGGCCTGGGCGGCAGCATCGCCG
CCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACCCGTTGACGGAGGCGGTCAACCTCAGAGCCCTGTGTCGGACCCGCAGTCGGAGCACTCGGAC
GAGAGTGGCTTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGA
TCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCT
GATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGTGGAAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAAT
ACATTCCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGATCAAGTGGGCAAACGTCACACG
AAGATCACGCTGGTCCAGGATACGGGACAGCAGCTGATCTTCATGGAGTTCGCGTAACTCCGTGGGTGAGTACTTAAGAGTCCCCATCCATGCCCAGAAC
ATGTCCTCACAAGAACTCCACGAGGAACAGCTCTCGGGCATAACCCAGAGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGAC
AAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGAACAACTGTTCTTTCTGAACAAGGAC
TCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGGACCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCAGGAGGC
CAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTCCTGGTCGAGGTCATTCGAGA
CCTCCCGGGGCTCAACGATAGCACCCTCCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCTTTATTCGAGGAGTCGGAGATACTCTGATAGGAGCGTCGACT
CTCCTTCTCCTCGAGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGACCCTCGGCA
AGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTGGCGGCCGGACTCTCGGAGCGCACAGACGTTCTGG
GACTGTGATCGCCTTGATCACTAGCGAGCGACTGCACGCTGACATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATC
GTGCGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCCACGAACCGAGGGTTCGGACGATTGTCTGAAGGAGAGGGCGACGGA
CTGCGGCGCTTGCTTGCTCGCTTGTCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGC
CGTGAGGCTTAGTGCTCTTGCCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGGTATCGGTCGA
ATTGGTGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGAC
TTTGAGAATAAGAGTTTGTGACGAACACCTCTTCACTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTG
TACCCTGGTTACATGAAGTGTGACACTTTACACTTCAGGTGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTATTAAGGTCGTTCAAAGCCAAC
CATTGGTCAAACGACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTA
TTTAGGTCACTTCGCTCTCTTTAACTAAAGAGGGGACCTGTGAGCTGCCGTTCACTGAGAGTTTGTATTCTCTCGGAAGATAACTTCCTCTAGCGCAAGG
TGCTGTGTGACCCCGTCACAAACAA