Description :
From Genome Similarity Track
Location :
contig_9:105832- 107373
Transcript NameFunction/comments
g2591.t1ETL83945.1 hypothetical protein L917_16186 [Phytophthora parasitica

Sequence
1541 bases(100 bases per row)
GCGTCACGCACAATGTGTGGACCGCCTACATCTTCACGTTCTTCTTCTGGTCCGCCCGAAGGTATCAATCGTCCCCAATGTAGCAAAATGTAGCCATGTA
TCATTCCTCACCTTGTCCGTCATCGCAACTGTAGTATTCTGTTCCAGCAGGTCGTGGCTGGCTACGTGTTCGTGCTCACGGCCTCCAACAAACCCGTGGG
TATCGTCAAGGGCATCCAGGGCATCTCGCAGCTCGTCTTCTCGCTACCCGGCGGCTATTTCGCGGATCGTATCCGTCGCGACACGATCCTGAAGCTCTCG
GGAGCCATTGGCATCGTCGGCGCCGTCATCACCTTCGTCTCCGTGGAGTTGACGTCCATCAACGGCCTCTACGTGGCGTTCGGGCTCTGGGGCCTCTTCG
CAGCCTGCCAGAGCCCCGCCATGGAGGCGTTGTTCGCTGACTCCATCCCCCCTGGCAAGCGTAGCTTCCCGTTCATGATCAAGTACAACATCAGCAACTT
GGCGCAGATGCTGGGGCCCGTGCTGAGCATCATGCTCTTTCTCTTCTACGGAGACCAGTGGCAGCTGCCGGAGCTCAAGCCTGTGCTCGAGTTCGGCTGT
GTCTTGGCTGTCGTGGGATCGCTCATCCTGTTCCAGTTCGATGACGACCGGGCCAAGGACTATCTGGTCGACAAGACTCAAGAGGAGAAGGAGGAGGAAG
TGCTGCTGGAGAAGATGATCGCACCGTCTCCGCTGCGCACGCCCAAGCTGGTAGGCAATGGTAATGAATTCGACATGGTGTACGACTACTCGGACGAAGA
CGACATCACAGTGGACGACAAGTCTCCCCCGACGGCGACCGAGAACACGGCGCTGCTGCTGCTGAAGGGAAAGACCGCCAAGGAGATGGATCTGGAACGA
CAGCAGCGTCTACAGGAGGTGGAGGAGGAGGAGGAGGGATACATGGCGCACCTGGACGCCAAGTTCCTCTGCTTTCGCACCAAGCACGTGCCGTACATCC
TGTTTGTGTCCGACTTTATCCTCAGCAACGGGGCCGGCATGACGATCAATTTCTTCCCGTTGTTCTTCAAGGAGGAGTACGGACTCACGCCGATTCACGT
CTGCGCGCTTTTCATGAGCCAGCCGCTTGTCGTCATGATCCTGTCGTTTATCGCGCAGCGGTTGTCCAAGCCGTGCGGACGCATGCCGATCATTGCCTTC
ACCCGCGCATTCTCCGTTGCGTGTCTATTCTCCATGGCGTACGCACAGCCGATGGCTCTGCAGATTGCGCTGTTCCTGATGCGTGGCGGGATGATGCGCT
GCTCGCAGCCTCTCCGTCGGTCGATCCTGATGGACTACGTGCCCAAGAACCTTCGTGCGCGCTGGAATGCTTTGGAGGGTCTGTCGGTCTTTTCGTGGTC
CGGTAGTGCAGTTCTCGGCGGCTTCTTGATCGACGCGTATGGATACCGAATGTGCTTCATCATCACGTCGTTCGTCTATTGCGTGGGTCTATCCTTCGAG
ATGGCTCTGTTGCCGCTCACAAAACACGCCGTTGAGAAATA