Description :
From Genome Similarity Track
Location :
contig_9:105819- 107360
Transcript NameFunction/comments
g2747.t1RAW38828.1 hypothetical protein PC110_g4948 [Phytophthora cactorum

Sequence
1541 bases(100 bases per row)
GCGTCACGCACAATGTGTGGACCGCCTACATCTTCACGTTCTTCTTCTGGTCCGCCCGAAGGTATCAATCGTCCCCAATGTAGCAAAATGTAGCCATGTA
TCATTCCTCACCTTGTCCGTCATCGCAACTGTAGTATTCTGTTCCAGCAGGTCGTGGCTGGCTACGTGTTCGTGCTCACGGCCTCCAACAAACCCGTGGG
TATCGTCAAGGGCATCCAGGGCATCTCGCAGCTCGTCTTCTCGCTACCCGGCGGCTATTTCGCGGATCGTATCCGTCGCGACACGATCCTGAAGCTCTCG
GGAGCCATTGGCATCGTCGGCGCCGTCATCACCTTCGTCTCCGTGGAGTTGACGTCCATCAACGGCCTCTACGTGGCGTTCGGGCTCTGGGGCCTCTTCG
CAGCCTGCCAGAGCCCCGCCATGGAGGCGTTGTTCGCTGACTCCATCCCCCCTGGCAAGCGCAGCTTCCCGTTCATGATCAAGTACAACATCAGCAACTT
GGCGCAGATGCTGGGGCCCGTGCTGAGCATCATGCTCTTCCTCTTCTACGGAGACCAGTGGCAGCTGCCGGAGCTCAAGCCTGTGCTCGAGTTCGGCTGT
GTCTTGGCTGTCGTGGGATCGCTCATCCTGTTCCAGTTCGATGACGACCGGGCCAAGGACTATCTGGTCGACAAGACTCAAGAGGAGAAGGAGGAGGAAG
TGCTGCTGGAGAAGATGATCGCACCGTCTCCGCTGCGCACGCCCAAGCTGGTAGGCAATGGTAATGAATTCGACATGGTGTACGACTACTCGGACGAAGA
CGACATCACAGTGGACGACAAGTCTCCCCCGACGGCGACCGAGAACACGGCGCTGCTGCTGCTGAAGGGAAAGACCGCCAAGGAGATGGATCTGGAACGA
CAGCAGCGTCTACAGGAGGTGGAGGAGGAGGAGGAGGGATACATGGCGCACCTGGACGCCAAGTTCCTCTGCTTTCGCACCAAGCACGTGCCGTACATCC
TGTTTGTGTCCGACTTTATCCTCAGCAACGGGGCCGGCATGACGATCAATTTCTTCCCGTTGTTCTTCAAGGAGGAGTACGGACTCACGCCGATCCACGT
CTGCGCGCTTTTCATGAGCCAGCCGCTTGTCGTCATGATCCTGTCGTTTATCGCGCAGCGGTTGTCCAAGCCGTGCGGACGCATGCCGATCATTGCCTTC
ACCCGCGCATTCTCCGTTGCGTGTCTATTCTCCATGGCGTACGCACAGCCGATGGCTCTGCAGATTGCGCTGTTCCTGATGCGTGGCGGGATGATGCGCT
GCTCGCAGCCTCTCCGTCGGTCGATCCTGATGGACTACGTGCCCAAGAACCTTCGTGCGCGCTGGAATGCTTTGGAGGGTCTGTCGGTCTTTTCGTGGTC
CGGTAGTGCAGTTCTCGGCGGCTTCTTGATCGACGCGTATGGATACCGAATGTGCTTCATCATCACGTCGTTCGTCTATTGCGTGGGTCTATCCTTCGAG
ATGGCTCTGTTGCCGCTCACAAAACACGCCGTTGAGAAATA