Description :
From Genome Similarity Track
Location :
Scaffold_13:105815- 107029
Transcript NameFunction/comments
Aphas_H257_05678Hypothetical protein
Aphas_H257_05679dynein light chain

Sequence
1214 bases(100 bases per row)
CAGATTCAAGTGGCCGAGGACGGCGACGTGCGTCTCGCCGCGGGGGCTCGCAAAAATGGGGAATATGCGACACCGTCTGAGTCGTTTCTCATCCGGCGCC
GCCGTCCGACTCTGTCTGTGGAGGACCTGGGGCTGCCTGTGCTCCAGTCGATTGGGCGTTTTCGGTACGCAGTGTGGGACCTCAAGGGCGAGCTCATCTC
AATCATCCAGCACGAACGCCGCAGTCGCGACGGTAGTATTCCTTCCTCCTCCGTCTGTGACGTGGTAACACTATATGTGACACGGGGACGACTGGATGGA
TGTAGCGGCCGAGAGCGTCCAGGATCGCCTTGTGGTCGGCGCGGTGCTCACCAACGCCTTGTGGGTCGGGGCGGCGCTGTACCAAGTGCTGTACGTGCGG
CGGTTGCTGGCTCGGGGGTAGATGGATGGAAGATATAAACCAAGTCTTGACAAATAGAAAGATACAATTCAATTGGGTTTTTTTTCTCACCGATATGTTA
TTATTGTCCGAGTATTTACGTTATTTGACGTCTAACTAAATCCACACACCACTCGCTTCAGATCCGTCTTCCGCCACGGCGGCGGCGGCGTCCCCGTCGT
CGTCGCTGTGCTCCATCACCCCCTGCAGCTTGTTGACTTCTTCGAGACCAGATAGCAGCACTCCCGCGGGGGCCGCCTGGTCTTCTGGAGCCAAATCCAA
GTCGTAAATGTGACTAGAGCAACCCCCACCACATATTGTTTATTCAAATCTGGAGTAGTCACGTGCCCGACTGTGTATCGATATAATGGGCAGATGCATT
GATAGAAAAGCATTTGAGCCAATCGGATTGCAGGAAAACATCAGTTCAGCCAATTAGTGTATGACTTCAATTCGTGTGATGGACATCCCTGCTTGACATG
GTTTGACATGCAAAATCCAGGGCAAAAGTCGATCGATGCATTGGGCAAATCAACACTTTTTGAGTAGAAACGACAATATAAATCACCAGGCCGTACCTCG
ATGCCCGCTTCAAGCCCGCGCCGCCCCCGCGACGCTGCTGTACCTGGATGACACTGTACGCCGTCTTGAGCGCGCCTTCCAGTGTCAGCAGCCAGTTGGT
CTTCTCCTCCATACTGTCGCAGCATAGCACGACTTTCCGCCCCTTGTTTAGCCCCACAGTCAACGCGTACTTGCGCCCTTCGAACAGTGTCACATTGCGC
ACCTACAGAAGTAT