Description :
From Genome Similarity Track
Location :
Scaffold_238:10581- 12341
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_238-snap-gene-0.11Ubiquitin
Pytir_DAOMBR486maker-pir_contig_238-fgenesh-gene-0.5Ubiquitin carboxyl-terminal hydrolase

Sequence
1760 bases(100 bases per row)
AGCAAACGTTCAACTTTGAGCCAGACAACACGGTGCGTTTTTGCTTTACGCCGTTGTTGGGTTGACTCTTCTCCAGGACCTTGACGGCATAATGAAGTAG
TACTGACTGAACCATGGCTATTGATTCTCCGCTTTTGTGTATGAACAGATCCTGCACGTGAAGCAGGCACTACAGGAGAAGGAAGGCATCCAAGTCGATC
AGATCAGGTGCGCTTTGCTTCCATGCACCTCTCTCTCTTTCTCTCTCTCTCTTTCCTTATCGCTTATCTAACGTGCGTGTGTCTACCGTTCTTGCGGTCC
CCACATTTTCGTGTTTAGATTGATCTACAGTGGAAAGCAACTGTAAGTTTCCTCCTTCACTCAGATCCGTCATCCTTGCTTGCTGTCAGTAAACACGCCA
AGCGATCTGTTTCTCATTATTGTGGCACTGTGTTCGTATGGCAATGTACCATTTTAGTGCCGACGACAAGACTCTCCAGGACTACAACGTTGCTGCCGGC
GGCACCATCCACATGGTGCTTCAGCTGCGTGGAGGCTGCTAAGCGCCTCGACCTACTGCATGGACCCGTAGAAGTACATGAAAGAAACGAGCGAGCGAAT
GAACGAGCGAACACTGCTCATGAACACCAAGAAGAGTCAGCAAGTCCCCACATCATAACCGCATGAACGAAAGGACCAAAGGCGCTATTTTTTAAATGAC
CCTTCGTCCCAAAGTGCTGTTCTCATGATGGCTTTAACTACCATATTCGTGCACTTCTGACTGTCCGTCTTCTTAATGAGCTCTACGCTTGAAAAGGGAT
AAGCCATCGTCGTTTTACTGGATAGCCGTCGCACTTGCATTGTTGCCGTTGTTGTCGTTGTTCTGCTCCAGTTGTTGCTTGATGAGCGGCTCCAGCTGTT
TCTTCTCTGCGAGCGTCTTGAGCAGTTGCACGATAAATGGGATGTAATTGTGCTTGCGGCGCGCGTTCTCCAGCGTCCAATTCTTCCGCTTCTGCTCTTC
ACCCGCAATCGAGCTCTGCAGCTGCGTGATCTCCTGCGCGATCTCTCCCTCCGACGACGACGAAATGGCCTGGAGCTGCGCGATTTTGTCCTGGAACACG
TCTATCCTGTTGCGCACCAGTGCCAGCAGGTTGAAACGGATCTCGGACGCCGCGTATTTCTCAATGCGCTTCTGGATCACGGGGCACGCGACCTGGAGCC
ACGCGTCTCGCTGGTTGTTGCTCGGCACGTCGCCCAGGCAAATCGGACCTTCGCGGAGCCCGTCAAGCTCGTACACCTTGCCGTTCACGGGCACGTACGC
TATGAAGTGGTAGACGTCATCGTCGCTCGTGGCCTTGCGCTCGTCCATCACAAACGGCTCGGGTCGCGAGAACGAGTTGTGCGTGACACGAATCTTCTCG
CTGTTGGAGATCGCGAGTCCCTTGAGGTCCGAGGGGAAGTCGCTCGTGAACGCCTTGAACTCGGACAGCGTCTCGCCCAGCTCAATGTCCTTGCAGTTCA
TCAGAATCGACAGGATAGCCTGCGTCGCGCACGCGTTGTTGATCACCTGTTTGGCGAAGAAGAGCCCCTCGTTCTCCTCCGCGTCGGTCGCATACGTCAC
GCTCTCGTGGTCCTGGCCGTGTGACGTCTCGTATTTGAAGAGAAACACGAGCCCGTGCACGGGCGCGAGCTCCGCGAACTGCTCCGAGTCCAACGAGTAC
AGTTCTTCCACCTGCACGCCTTTCACGCCGATGTCTTCGATCAGCGACGTGAACACGCCT