Description :
From Genome Similarity Track
Location :
Scaffold_4:1058052- 1059314
Transcript NameFunction/comments
Aphin_H310_05479ATP-binding Cassette (ABC) Superfamily

Sequence
1262 bases(100 bases per row)
GACGACGATGTGAAAGCTGAGGAAAATCGCGTCGCGTCTGGTGCCGCCAACGATCACGCCGTCGTGATCAAGAACTTACGAAAGGTGTACAAAGGCGGGA
AAGTGGGGCTCAAGGACTTGTCGGTCGCGTTGCCAAAAGGCGAATGTTTTGGCTACCTTGGCATCAACGGCGCCGGCAAAACCTCCACGATGAAGATCCT
CACGGGCGACAGCCTCGCGACCTCGGGGTCCGCCATGCTCGGCGGGTTTGACATCTTGTCCCAACAGTTGGAAGTGCGCCGATTGATCGGGTACTGCCCC
CAGTTTGACGCGTTGATCGACTTGCTGACGGTCCGCGAACATTTGGAATTGTTTGCGGCCATCAAGGGTGTCCCCAAGCAGTTTGTGAACGACACAGTGA
TGAAAAAGATGGACCAAATGAACTTGAACGACTTTGAGCACAAGCTGGCCGGGACGTTGAGCGGCGGGAACAAGCGCAAGCTGTCAGTCGCGATTGCCAT
GATCGGGTCGCCTCCGATCATCTTCCTGGACGAGCCGTCGACGGGGATGGACCCGGTGTCCCGTCGGTTCATGTGGGACGTCATCGCGGACATTTCGACC
CGTAGCAAAGAATCCACGATTCTCCTCACGACGCACAGCATGGAAGAGTGCGAAGCGCTGTGCAGTCGCGTCGGAATCATGGTAGGTGGCGCGTTGAGCT
GCCTCGGGAGCATCCAACATTTGAAGAACCGGTTTGGCGACGGGCTCATGATGCATGTTCGCGTGGCGCCCGTGCTGTCGGCCGACGTCGACCGCATGAT
GAGCGAGTCGTCGTCGTTTGCTGGCATGTCCACACTAACCAAGGAACGCCTTGCTGAAACGTGCGCGGGGCTGGGCAAGCCGCATCGCGCGGAACAAATC
CACATGGATCATGCGACGGGGTATGTGCTGGCCGAGTCATTGGCGCGCAACGATTCGATTCGCGTGCACGACTTTTGCGCGTGGTGGTTGAGTGAAGACC
GCTTCGACGCCATGGCGGCGTACCTGGGCCAGAGCTTTGGCGAGCCGAACGTGTTGCTGCTGGAGCGCCAGAACGACGTGTCGCGGTTCAAGTTGGTGGG
CGCCAAGCACTCGCTGGCGCTGTCGAATGTGTTTTCGCTCATCGAACGGGCCAAACGAGACCTGAATATCAAGGAGTACACCGTGTCCCAGACTACGCTC
GAGCAAATCTTCAACAACTTTGCGGCCCAGCAAACGCAAGAAAAGGGCGTCGCGCGCGGCGT